מֵידָע

כיצד לקבוע את הרצף השמור ביותר מתוצאת הפיצוץ?

כיצד לקבוע את הרצף השמור ביותר מתוצאת הפיצוץ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

השתמשתי ב- BLAST כדי למצוא את רצף ה- DNA המיושר ביותר לרצף השאילתה שלי. תוצאת ה- BLAST מציגה מספר רצפים שהיא חישבה להיות הרצפים המיושרים ביותר לרצף השאילתות שאני נותן. לכל אחד מהרצפים המיושרים האלה יש ציון של ערך אלקטרוני המייצג את הפגיעה הטובה ביותר במקרה.

שאלתי היא כיצד אוכל לקבוע אם רצף השאילתות שמור מאוד עם הרצף המיושר, או לא? האם אני יכול לקבוע שאומר שהרצף בעל ערך האלקטרוני המתאים ביותר (ערך אלקטרוני נמוך יותר) הוא זה שנשמר ביותר? או שיש מושגים אחרים שעלי לקחת בחשבון במקרה זה?

אני מעריך את עזרתך!


ה"טוב ביותר" הוא זה עם ציון הזיהוי הגבוה ביותר, הערך האלקטרוני הנמוך ביותר והאורך הגדול ביותר. אין כדור קסם, כל אלה חשובים. אתה תמיד צריך לחפש את הרצף הדומה ביותר שמתאים ככל האפשר לשאילתה שלך עם הערך האלקטרוני הנמוך ביותר האפשרי.

יתר על כן, זה תלוי במה אתה מסתכל. אם, למשל, אתה מפוצץ חלבון עם תחום ספציפי ומחפש למצוא את ההומלוג שלו במין אחר, לעתים קרובות יותר חשוב שהתחום ישמר מאשר שהרצף כולו יהיה זהה מאוד. אם אתה מוצא רצף בעל זהות גבוהה אך שבו הדומיין אינו נשמר, כנראה שזה לא מה שאתה מחפש.


כיצד לקבוע את הרצף השמור ביותר מתוצאות BLAST? - ביולוגיה

הסל שלך ריק כרגע. i & ltp> בעת גלישה בין חלבוני UniProt שונים, תוכל להשתמש ב'סל 'כדי לשמור אותם, כך שתוכל לחזור למצוא או לנתח אותם מאוחר יותר. & ltp> & lta href ='/help/basket 'target =' _ top '> יותר. & lt/a> & lt/p>

בחר פריטים ולחץ על "הוסף לסל" כדי ליצור אוסף משלך כאן
(400 כניסות לכל היותר)

פפטיד איתות

שונה לאחרונה ב -12 במרץ, 2019

תת-סעיף זה של סעיף 'PTM / Processing' מציין את נוכחותו של פפטיד אות N-טרמינלי.

פפטידים של אותות נמצאים בחלבונים הממוקדים לרטיקולום האנדופלזמי ובסופו של דבר מיועדים להיות מופרשים/חוץ -תאיים/פריפלזמיים/וכו ', הנשמרים בלומן של הרשתית האנדופלסמית, של הליזוזום או של כל אברון אחר לאורך מסלול הפרשה או להיות חלבוני ממברנה במעבר יחיד.

רצף האותות מוסר בדרך כלל בחלבון הבוגר במקרים אלה, ההערה 'הרצף המוצג מעובד לצורה בוגרת' מתווספת בסעיף 'רצף'.

1. ביאור של פפטידים אות מוכחים בניסוי

אנו מביאים הערות לפפטידי אות שהוכחו בניסוי כאשר אתר המחשוף נקבע על ידי רצף חלבון ישיר.
דוגמה: P01165

לאחר מכן ניתן להפיץ מידע זה 'על ידי דמיון' למינים קרובים בתנאי שרצף האותות נשמר.
דוגמה: Q8CW46

כאשר ברור שחלבון נבקע (על פי נתוני ניסוי או הדמיון שלו למשפחת חלבונים), אך לא נעשה שימוש ברצף חלבון ישיר לקביעת מיקום המחשוף המדויק, אנו משתמשים בסימן שאלה במקום במיקום.
דוגמה: Q9VGW1

במקרים נדירים, רצפי האותות אינם נחקרים. זה מצוין על ידי ההערה 'לא מבוקע' בתיאור התכונה.
דוגמה: O95445

2. ביאור של פפטידים אות חזוי

אנו מפרשים פפטידים של אותות אשר ניבאים על ידי יישום כלי הניבוי Phobius, Predotar, SignalP ו- TargetP. לפחות שתי שיטות חייבות להחזיר חיזוי פפטיד אות חיובי על מנת שהניבוי יוצג ב-UniProtKB. כאשר פפטידים של אותות N מסופנים ואזורי טרנסממברנה חופפים, אז התחזית שהחזיר פוביוס משמשת להפלות בין שתי האפשרויות.
דוגמה: Q6Q788

3. ביאור של רצפי אותות Tat בחיידקים וארכיאה

סעיף קטן זה משמש גם לביאור חלבונים עם רצף אותות טאט (טווין-ארגינין טרנסלוקציה), המשמש טרנסלוקציה של חלבונים מקופלים בחיידקים ובארכאיות. חלבוני המצע מופנים למנגנון הטאט על ידי פפטידי אותות ייחודיים ל- N המכילים מוטיב קונסנזוס SRRxFLK 'תאום-ארגינין'. את ההערה הקשורה "צפויה לייצא על ידי מערכת Tat" ניתן למצוא בסעיף המשנה 'שינוי לאחר תרגום'.
דוגמה: P36649
רצפי אות TAT צפויים מזוהים באמצעות פרופיל PROSITE PS51318.
אתרי מחשוף צפויים מתויגים עם הוכחות 'ניתוח רצף' או עם כלל הביאור האוטומטי שממנו הופצה התוצאה החזויה.
דוגמה: P36649

ב UniProtKB/TrEMBL, פפטידי האות מבוארים באופן אוטומטי על ידי מודול ביאור הרצפים שלנו באמצעות SignalP.


EFI - כלי דמיון לאנזים

רשת דמיון רצפים (SSN) מאפשרת הדמיה של מערכות יחסים בין רצפי חלבון. ב-SSN, החלבונים הקשורים ביותר מקובצים יחד באשכולות. כלי הדמיון לאנזים (EFI-EST) מאפשר ליצור בקלות SSNs. Cytoscape משמש לחקר SSN.

רשימה של תכונות חדשות ומידע אחר הנוגע ל-EST זמין בדף הערות הגרסה.

ניתן להשתמש בחיפוש רצפים של InterProScan לאיתור התאמות בתוך מסד הנתונים של InterPro עבור רצף נתון.

מידע על משפחות ומשפחות Pfam וגדלים משפחתיים של InterPro זמין בדף מידע משפחתי.

צור SSN עבור חלבון בודד וההומולוגים הקרובים ביותר שלו במסד הנתונים של UniProt.

רצף הקלט משמש כשאילתה לחיפוש במסד הנתונים של UniProt באמצעות BLAST. רצפים הדומים לשאילתה ב- UniProt מאוחזרים. פיצוץ הכול מתבצע כדי להשיג את הדמיון בין זוגות רצפים לחישוב ערכי קצה ליצירת ה- SSN.

צור SSN עבור משפחת חלבונים.

הרצפים מהקלט של משפחות Pfam, משפחות InterPro ו/או שבט Pfam (משפחות-על). BLAST הכל-לכל-כל מבוצע כדי להשיג את קווי הדמיון בין צמדי רצף כדי לחשב ערכי קצה ליצירת ה-SSN.

צור SSN מרצפים שסופקו.

פיצוץ הכול מתבצע כדי להשיג את הדמיון בין זוגות רצפים לחישוב ערכי קצה ליצירת ה- SSN.

הזן רשימה של רצפי חלבון בפורמט FASTA או העלה קובץ רצף בפורמט FASTA.

צור SSN מרשימת מזהי UniProt, UniRef, NCBI או Genbank.

פיצוץ הכול מתבצע כדי להשיג את הדמיון בין זוגות רצפים לחישוב ערכי קצה ליצירת ה- SSN.

אשכולות ב- SSN המוגשים מזוהים, ממוספרים וצבעוניים. טבלאות סיכום, קבוצות של מזהים ורצפים לכל אשכול מסופקים.

האשכולות ממוספרים וצבעוניים באמצעות שתי מוסכמות: 1) מספר אשכולות ספירת רצפים הוקצו לפי סדר ירידה במספר מזהי UniProt באשכול 2) מספר אשכול ספירת צמתים מוקצה לפי הורדת מספר הצמתים באשכול.

בדומה לכלי השירות Color SSN, אשכולות ב- SSN שהוגשו מזוהים, ממוספרים וצבועים.

אשכולות SSN ממוספרים וצבעוניים באמצעות שתי מוסכמות: מספר אשכולות ספירת רצפים מוקצים לפי הורדת מספר מזהי UniProt באשכול מספרי אשכולות ספירת צמתים מוקצים בסדר של ירידה במספר הצמתים באשכול.

גם יחס ההתכנסות עבור כל אשכול מחושב. יחס ההתכנסות הוא מספר הקצוות בכל אשכול למספר זוגות הרצף. הערך יורד מ -1.0 עבור אשכול רצפים דומים מאוד (אותה פונקציה?) ל- & lt & lt1.0 עבור אשכולות עם רצפים קשורים מרחוק (פונקציות שונות?).

יישומי רצף מרובים (MSA), WebLogos, דגמי Markov נסתרים (HMM), היסטוגרמות אורך ושאריות קונצנזוס מחושבים לכל אשכול.

אפשרויות זמינות בכרטיסיות להלן לבחירת הניתוחים הרצויים:

ה לוגו אינטרנט הכרטיסייה מספקת את WebLogo ו- MSA עבור מזהי הצמתים בכל אשכול המכילים יותר מה- "ספירת צמתים מינימלית"המפורט ב מסנן רצף כרטיסייה.

ה שאריות קונצנזוס הכרטיסייה מספקת קובץ טקסט מופרד בכרטיסייה עם מספר השאריות השמורות ומיקומי ה- MSA שלהם עבור כל שאריות שצוין בכל אשכול המכיל גדול מ- "מספר הצומת המינימלי". שים לב שאריות ברירת המחדל הן" C "ואחוז רמות הזהות המוצגות הן בין 90 ל -10% במרווחים של 10% שארית נחשבת כ"שמורה" אם היא מתרחשת עם & ge80% זהות.

ה חברות HMM הכרטיסייה מספקת את ה-HMM עבור כל אשכול המכיל יותר מה-" שצויןספירת צמתים מינימלית".

ה היסטוגרמות אורך הכרטיסייה מספקת היסטוגרמות אורך עבור כל אשכול המכילים יותר מה-" שצויןספירת צמתים מינימלית".

צמתים ב- SSN המוגשים נצבעים על פי קישוריות השכונה (מספר הקצוות לצמתים אחרים).

הצמתים של משפחות לא פתורות יכולים להיות קשים לזיהוי ב-SSNs שנוצרו עם ציוני יישור נמוכים. צביעת הצמתים לפי מספר הקצוות לצמתים אחרים (קישוריות לשכונה, NC) עוזר לזהות משפחות עם צמתים מחוברים מאוד (https://www.biorxiv.org/content/10.1101/2020.04.16.045138v1.full). שימוש צביעת קישוריות לשכונה כמדריך, ניתן לבחור את סף ציון היישור ב-Cytoscape כדי להפריד את ה-SSN למשפחות.

גרסת UniProt: 2021_02
גרסת InterPro: 85

ב- UniRef 90, רצפים המחלקים זהות רצף של 90 % מעל 80 % מאורך הרצף מקובצים יחדיו ומיוצגים על ידי מזהה הצטרפות המכונה מזהה האשכול. פלט SSN שווה ל- 90 % רשת צומת נציג כאשר כל צומת תואם לזהות אשכול UniRef, ואשר תכונת הצומת "מזהי אשכול UniRef 90" מפרטת את כל הרצפים המיוצגים על ידי צומת. UniRef 90 SSNs תואמים את כלי ה- SSN Color וכן את הכלי EFI-GNT.


כיצד לקבוע את הרצף השמור ביותר מתוצאת הפיצוץ? - ביולוגיה

ספריית NIH מציעה מספר קורסי ביואינפורמטיקה המתארים את השימוש היעיל והיישומים המעשיים של משאבי ביואינפורמטיקה זמינים.
אורך הקורסים שעתיים וכולל גם הרצאה/הדגמה והפעלה מעשית.

אנא עיין ב דף אינטרנט של ביואינפורמטיקה ללוח הזמנים של ההכשרה ומשאבי ביואינפורמטיקה אחרים המוצעים על ידי ספריית NIH.

בשיעור זה, התלמידים ימצאו גן בתוך רצף ה- DNA האיקריוטי. לאחר מכן הם ילמדו כיצד לחזות את הפונקציה של מוצר החלבון המרומז על ידי חיפוש דמיון ברצף לחלבונים בעלי תפקוד מתועד באמצעות BLAST וכלים אחרים. לבסוף, התלמידים ימצאו תבנית דוגמנות תלת-ממדית עבור רצף חלבון זה באמצעות חיפוש מסד נתונים של דומיינים. במהלך השעה הראשונה, המדריך יעביר את התלמידים דרך ניתוח של רצף גנומי לא מאופיין מתוך רשומה של GenBank. במהלך השעה השנייה של השיעור, התלמידים יבצעו את אותו ניתוח על רצף גנומי אחר.

קורס זה מתאר כיצד להשיג מידע על גן אנושי בכל הרמות של הדוגמה המרכזית של החיים, הגנום, התעתיק והחלבון, וגורמי שעתוק המווסתים את ביטויו. זה מכסה גם מידע על פולימורפיזמים נוקלאוטידים בודדים (SNPs) בגן ואיזה ידוע כקשור למחלה. למידע נוסף.

במהלך השעה הראשונה, מדריך ינחה אתכם בניתוח של גן אנושי שנמצא בבעיה 1. במהלך השעה השנייה של השיעור תבצעו את הניתוח הדומה לגן אנושי אחר כמתואר בבעיה 2.

הנושאים שיש לעסוק בהם כוללים:

א. היתרונות של תוכניות BLAST שונות כגון blastn, blastp, tblastn ומתי להשתמש באיזו
ב. כיצד להגביל את החיפושים שלך כדי להפוך אותם לספציפיים יותר
ג כיצד להבין את התוצאות

קורס זה מדגים כיצד להשתמש ב- BLAT כדי למפות רצף cDNA/mRNA לגנום לזיהוי מיקומי אקסון-אינטרון ברצף הגנומי ורצף חלבון לגנום לחיפוש בני משפחה של גנים בגנום. זה גם מדגים כיצד לדמיין את היישור בדפדפן הגנום של UCSC ולהשוות את התוצאות לחיפוש דומה שנעשה באמצעות BLAST של NCBI.

קורס זה עוסק כיצד להמחיש ולערות מבני חלבון תלת -ממדיים באמצעות תוכנית ה- Cn3D של NCBI, לזהות תחומים ושמירה על אתרי קישור ליגנד בחלבון, לחפש חלבונים אחרים המכילים תחומים דומים, לחקור תבנית דוגמנות תלת -ממדית לחלבון השאילתה. ולמצוא הומולוגים רצופים רחוקים שאולי לא יזוהו על ידי BLAST.

בקורס זה, נשתמש בדפדפני הגנום מ-NCBI, UCSC ו-Ensembl. המשמשים לצפייה בהרכבה של הגנום האנושי השלם, דפדפנים אלה הם כלים חשובים לזיהוי ולוקליזציה של גנים וקבלת מידע עליהם. בקורס זה נראה כיצד ניתן לצפות במפות/רצועות גנום אנושיות שונות ולנצל אותן בצורה הטובה ביותר. לדוגמה, ניתן להשתמש במפת ה- EST לזיהוי אקסונים ללא תעודה או ליצירת תוצרי שחבור חלופיים של גנים.

קורס זה עוסק בזיהוי גן למחלה באמצעות מכלול הגנום האנושי של NCBI. מכלול הגנום ההפניה, יחד עם מפות, ספרות ומידע ביטוי משולב כולל מערכת גילוי עוצמתית לחקר גנים למחלות אנושיות מועמדות.

נתחיל ברצפים מבוטאים המתקבלים ממטופל, נזהה את הגנים המבטאים אותם, נוריד את רצפיהם ונזהה SNPים ידועים ברצפים המובעים, אם בכלל, שעשויים לתרום לפנוטיפ של המחלה.

קורס זה מתמקד בקורלציה של גן מחלה לפנוטיפ. הוא מדגים כיצד משאבי ביואינפורמטיקה כגון ספרות, ביטוי ומידע על מבנה יכולים לסייע במתן מידע תפקודי פוטנציאלי לגנים של מחלות.

קורס זה מתאר כיצד לקבוע מה ידוע על מחלה, הגנים הקשורים אליה והבדיקות הגנטיות שלה. לאחר מכן נבהיר את הבסיס הביוכימי והמבני לפנוטיפ הנגרם על ידי החלבון המוטנטי.

קורס זה מתאר כיצד לגשת לרצפי הגנום והחיידקים של החיידקים, מסביר כיצד לנווט ולהוריד את מערכי הנתונים של הגן והחלבון, ומציג את כלי הניתוח הגנומי וההשוואתי הזמינים של NCBI, IMG ו- EcoCyc.

במהלך השעה הראשונה תינתן סקירה באמצעות אי - קולי כדוגמה כפי שמתואר בבעיה 1. במהלך השעה השנייה של השיעור, תבצעו ניתוח דומה על אורגניזם אחר.

קורס זה מתאר את הניתוח של נתוני מיקרו-מערך לביטוי גנים. הוא מראה כיצד להגדיר את המידע הדרוש לתיאור הניסוי כיצד לנתח את הנתונים וכיצד לפרש את תוצאות הניתוח.

רצף מקביל באופן מסיבי, המכונה גם רצף הדור הבא, הוא טכנולוגיה המאפשרת רצף תפוקה גבוהה של גנומים או מוקדי עניין. קורס זה מתמקד במוקד יחיד. הוא בוחן את איכות הרצף קורא מיפוי של קריאות והדמיה. זה גם בוחן וריאציות ברצף.

שיעור זה מדגים כיצד לחפש רשומת ביטוי באומניבוס ביטוי גנים (GEO), להשיג גנים המתבטאים באופן דיפרנציאלי ומידע על העשרת מסלולם.

שיעור זה מתאר כיצד לגשת למידע אודות גנים וגרסאותיהם הקשורות למחלות והשפעת הגרסאות על תגובת התרופה והנחיות המינון. המחלקה מספקת גם מבוא לקביעת ההשפעה של הווריאציות על תפקוד, פתוגניות או מזיקות.

כלי Galaxy יכולים לשמש לשילוב נתונים והם שימושיים במיוחד לשילוב קבצים עם קואורדינטות גנומיות. לדוגמה, ניתן לצרף קובץ עם רשימת SNP ומיקומי הגנום שלהם עם קובץ גנים ומיקומיהם כדי לקבוע חפיפה. סוג אחר של שילוב נתונים הוא עבור קבצים המכילים את אותם סוגי מזהים. לדוגמה, ניתן לחבר קובץ של מזהי גנים וערכי ביטוי עם קובץ של מזהי גנים והערות.

אחד הקשיים בקריאת מאמרים בכתב עת הוא למצוא מספיק מידע כדי לשחזר את התוצאות. קונסורציום ENCODE Project טיפל בבעיה זו על ידי הנגשת מכונת הווירטואלית ENCODE כחומר משלים לפרסומם, "אנציקלופדיה משולבת של יסודות DNA בגנום האנושי" (http://www.nature.com/nature/journal/v489/n7414/ מלא/nature11247.html). בדרך זו, קוראים שרוצים לשחזר דמויות בעיתון ולהבין פרטים של חלק מהניתוחים, יכולים לגשת לתוכנות קוד פתוח ולנתונים בתוך סביבת לינוקס, שכבר הוגדרה להפעלת התוכנה. בקורס זה ניתנות פקודות לשחזור דמות במאמר ושילוב נתונים ליצירת התוצאות עבור הדמות. הנתון שנבחר הוא להשוואה של מקטעי קישור גנום חזויים עם לוקוסים של גורמי שעתוק.

קורס זה לא רק נותן את מידע הרקע כיצד לגשת לנתוני TCGA ולהבין סוגי נתונים ורמות שונות, אך החשוב ביותר מספק מבוא לשימוש בכלים זמינים ברשת מקוונים לניתוח הנתונים להפקת מידע בעל משמעות ביולוגית. הקורס יציג שתי גישות של אנליזה, ממוקדי סרטן(ים) (מסרטן לגנים שעברו מוטציה משמעותית) וגנים ממוקדים (מגן אחד או יותר למספר סוגי סרטן).

ממשק שורת הפקודה UNIX (CLI) מספק גישה עוצמתית לקבצי מחשב, במיוחד לפעולות מורכבות במספר קבצים בו זמנית. תרגיל זה אינו מניח ידע מוקדם ב-UNIX או לינוקס. זה מכסה את היסודות של פעולות קבצים ותיקיות. נושאים נוספים מכוסים גם כגון מציאת קבצים ומידע בקבצים, לולאות ותסריטים של מעטפת. נתונים לדוגמה המשמשים מבוססים על קבצים מ-UniProt ומ-Sequence Read Archive. לדוגמה, אנו יכולים לגלות איזה שם של אורגניזם מופיע בתדירות הגבוהה ביותר בקובץ UNIPROT. או שנוכל לברר את מספר אי ההתאמות לקריאות מיושרות בקובץ bwa SAM.

פרויקטים של ביואינפורמטיקה כוללים לעתים קרובות קבצים עם נתונים טבלאיים. היכולת לבחון קבצים אלו על ידי סינון וסיכום, או לתמרן אותם על ידי הצטרפות, מסופקת על ידי SQL (Structured Query Language). בפרט, יישום SQLite מספק פלטפורמה מינימלית ללימוד היסודות של SQL. מכיוון שניתן להריץ SQL משורת הפקודה, ניתן לשלב אותו בקלות בצינורות ניתוח נתונים. דוגמאות יילקחו מפרויקטים של ביואינפורמטיקה.

פייתון היא שפת סקריפטים המקובלת בדרך כלל ללימוד תכנות מחשבים ואוטומציה של משימות כגון עיצוב מחדש של פלט מיישום אחד לצורך קלט ליישור אחר רצף או בניית זרימות עבודה. שיעור זה מבקש לספק למשתמשים טעם של פייתון ומספיק מיומנויות והבנה לשימוש בכלי פייתון שנבנו מראש לבחינת נתונים. הכיתה משתמשת בפיתון 3.5 וב-Jupyter. Jupyter הוא אפליקציית אינטרנט שבה ניתן להקליד ולבצע הצהרות python.


תועלת ודיון

מסד הנתונים המלא של CoSMoS זמין כהורדה [10]. ניתן להשתמש באתר CoSMoS כדי לבצע שאילתות וחיפוש במסד הנתונים של CoSMoS בדרכים שונות [11]. הפלט של תוכנית החיפוש ניתן להתאמה אישית מאוד, המאפשר למשתמש לחדד את החיפוש ולשנות את אפשרויות הפלט באופן נרחב ובכך להתאים את הפלט למטרה הספציפית. בנוסף, הוגדרו אפשרויות ברירת מחדל עבור כל הכלים המספקים תוצאות בצורה מובנת וקלה למעקב, הדורשת רק אינטראקציה מועטה מהמשתמש.

חיפוש מוטיבים של CoSMoS

CoSMoS Motif Search הוא כלי רב עוצמה המבוסס על ביטוי רגיל המאפשר למשתמשים לזהות במהירות מוטיבים של רצף שמורים מאוד בכל החלבונים המקודדים ב- אי - קולי גנום. תפוקת החלבונים המחזיקים מוטיב זה מסודרת לפי הרלוונטיות האבולוציונית. באמצעות הגדרות ברירת המחדל, המשמעות האבולוציונית של קבוצה מסוימת של חומצות אמינו מחושבת על ידי שימוש הן במספר המוחלט של חומצות אמינו זהות או דומות במיקום הנתון הזה והן במספר הכולל של רצפים הומולוגיים. זה הכרחי כדי להימנע מהעדפת חלבונים עם התאמות מועטות בלבד בחיפוש ההומולוגיה (בדרך כלל ב- Escherichia, סלמונלה ו שיג'לה סוג) אך דמיון רצף גבוה מאוד. גם השימוש במספר המוחלט של חומצות אמינו תואמות לא היה מספיק, כי זה מעדיף את החלבונים, שיש להם מספר רב של הומולוגים במאגר הנתונים של RefSeq. מסיבות אלה בחרנו באלגוריתם שדירג את התוצאות הן על פי ערך השימור המוחלט והן על פי ערך השימור היחסי:

1 א.) ספרו את מספר הרצפים ההומולוגיים בעלי חומצת אמינו זהה או דומה במיקום שצוין ("ציון שימור מוחלט").

1 ב.) חלקו את "ציון השימור המוחלט" במספר הכולל של חלבונים הומולוגיים ("ציון שימור יחסי")

2 א.) דרג את המוטיבים לפי "ציון השימור המוחלט" ("דרגה מוחלטת").

2 ב.) דרג את המוטיבים לפי "ציון שימור יחסי" ("דירוג יחסי").

3.) הקצה לכל מוטיב את הגרועה (הגדולה מספרית) מבין 2 הדרגות ("דרגה מוקצית").

4.) דרג שוב את המוטיבים לפי "הדרגה שהוקצתה" ("דירוג כולל"). אם ל-2 מוטיבים יש את אותה "דירוג מוקצה", המוטיב בעל "הדרג היחסי" הטוב יותר (נמוך יותר מבחינה מספרית) מקבל את ה"דירוג הכללי" הטוב יותר.

הפלט של חיפוש מוטיב CoSMoS מורכב מטבלה המציגה את כל המופעים של המוטיב לפי ה"דירוג הכללי" (איור 2B). ציוני השימור המוחלט והיחסי מבוססים על מחרוזת שקילה שניתן לשנות על ידי המשתמש ב"חיפוש מוטיבים מתקדם", למשל כדי לכלול חומצות אמינו דומות או כדי לא לכלול חלקים מסוימים של המוטיב מלהיחשב בחישוב.

אתר CoSMoS. (א) ניתן להשתמש בכלי האינטרנט לחיפוש מוטיבים לחיפוש מוטיבים ברצף קטן. (ב) התוצאה מוצגת בטבלה המכילה מידע אודות שימור חומצות האמינו במוטיב וקישורים ליישור (מוצג כאן עם אפשרות "חיתוך כל הפערים") (C) ודף המידע על הגן CoSMoS (D ).

משאבים אחרים מבוססי אינטרנט לזיהוי מוטיבים כמו ה MOTIF-SEARCH ו- ScanProsite משתמשים בגישה אחרת [12, 13]. תוכניות אלה מתמקדות בחלבון ודורשות קלט של רצף חלבון, אשר נסרק לאחר מכן לאיתור מוטיבים ידועים או מוטיבים המוגדרים על ידי המשתמש. הוא מספק למשתמש את המקרים המוטיבים הללו נמצאים ברצף. הגישה שלנו היא מוטיב ממוקדת ודורשת קלט של מוטיב שתואר בספרות או הוגדר באמצעות כלים כמו ה MOTIF-MAKER או MEME [12, 14]. לאחר מכן מחפשים את כל הפרוטום אחר המוטיב הספציפי הזה וכל המופעים מוצגים לפי סדר האבולוציוני שלהם כדי להקל על המשתמש להבחין בין חלבונים בעלי סטטיסטיקה גרידא לבין חלבונים עם הופעה רלוונטית מבחינה תפקודית של מוטיב זה. כלי דומה במקצת הוא eMOTIF-SCAN שעושה חיפוש ביטויים רגילים במאגר הנתונים של SwissProt, אך הוא חסר את היכולת המכריעה לדרג חלבונים אלה לפי המשמעות של רצף החלבונים [12].

מסופק קישור לערך NCBI RefSeq ולדף המידע של CoSMoS עבור החלבון המדובר וכן קישור ליישור ששימש לחישוב המשמעות האבולוציונית. אם תרצה, ניתן לצפות במערכי הרצף המרובים הגדולים לעתים קרובות במיוחד במלואם, אך הפלט הסטנדרטי מציג רק את יישור הרצף המרובה דחוס ל -20 הרצפים המגוונים ביותר (איור 2C).

מידע על חלבון CoSMoS

CoSMoS Protein Info הוא כלי המציג מידע הומולוגיה עבור חלבונים בודדים וניתן לחיפוש לפי שם גן או RefSeq ID [15]. לכל אחד אי - קולי חלבון, מוצג דף המספק מידע על שימור כל חומצת אמינו בחלבון זה (איור 2D). התפוקה מקודדת בצבע, מדורגת מאדום עבור חומצות אמינו הנשמרות ביותר דרך כתום, ירוק ולבסוף לאפור עבור חומצות אמינו משתנות מאוד. לפיכך, אזורים שמורים מאוד וחשובים ככל הנראה של החלבון ברורים ככתמים בצבעים עזים ברצף (איור 2 ד). ניתן לראות את היישור הבסיסי ששימש לחישוב המידע ההומולוגי של החלבון המוצג וניתן קישור לערך NCBI RefSeq.

מוטיב התיאורדוקסין כדוגמה

יישום אפשרי אחד של CoSMoS הוא לחפש מוטיבים של רצפים שמורים אי - קולי חלבונים. חיפוש אחר "CGPC" (איור 2 א), מוטיב האתר הפעיל לתיאורדוקסינים מגלה חמישה אי - קולי חלבונים המכילים בדיוק את המוטיב הזה. ניתן ליישם הגדרות רחבות יותר של מוטיב זה שימצא גם מוטיבים דומים באמצעות ביטויים רגילים המוסברים בסעיף העזרה, אולם יש לציין כי CoSMoS מוצא התאמות המבוססות אך ורק על הרצף הראשי ואינו משלב מידע מבני. התוצאות רשומות בטבלה כאשר התוצאות הרלוונטיות ביותר מופיעות בראש (איור 2B). כל שורה בטבלה מייצגת הופעה אחת של המוטיב. ניתן מידע רלוונטי על שם הגן, שימור המוטיב הכולל וחומצות האמינו הבודדות. קישורים מצביעים על ערך RefSeq התואם, נתוני היישור הבסיסיים ודף המידע של CoSMoS חלבון עבור החלבון. החלבון עם מוטיב ה-CGPC השמור ביותר הוא TrxA (Thioredoxin 1). דף המידע על חלבון CoSMoS עבור TrxA מציג את כל חומצות האמינו של Thioredoxin 1, יחד עם מידע מקודד צבע על שימור חומצת אמינו זו בהשוואה לחומצות האמינו האחרות ב-TrxA (איור 2D). חומצות אמינו בעלות ציוני שימור גבוהים יותר מחומצת האמינו הממוצעת בחלבון הן כתומות ואדומות, ואילו חומצות אמינו משתנות מאוד מוצגות בגווני אפור. לחיצה על הקישור למוטיב ה-CGPC המדובר ממקדת את הדף במוטיב ומראה בבירור שהאזור שמסביבו הוא אחד המאפיינים השמורים ביותר של חלבון זה. גלילה מהירה בדף חושפת מאפיינים משומרים אחרים, המסומנים באדום וכתום, למשל P77, T78. הקישור לקובץ היישור מציג את TrxA ב-Multiple Sequence Alignment בהקשר של ההומולוגיות שלו (איור 2C). לחיצה על הקישור למוטיב CGPC גוללת את העמוד למיקום הרלוונטי ביישור הרצף המרובה.

חלבונים נוספים שנמצאו כוללים את TrxC (Thioredoxin 2) המדורג במיקום 2 עם ציון שימור כמעט זהה ל-TrxA ושלושה חלבונים בדירוג נמוך יותר שאינם חברים במשפחת החלבונים thioredoxin אך בכל זאת מכילים מוטיבים של CGPC. בדיקה של היישור של החלבון בעל הדירוג הנמוך ביותר, YhbJ, על ידי לחיצה על הקישור המצורף מגלה שההתרחשות של מוטיב זה בחלבון זה היא בעלת אופי סטטיסטי.

התפתחויות עתידיות

אנו מרחיבים כעת את בסיס הנתונים כך שיכסה מינים אחרים מלבד אי - קולי K12 כולל Saccharomyces cerevisiae ו Caenorhabditis elegans. אנו גם מבצעים אוטומציה של תהליך בניית מסדי הנתונים ונספק את הכלים הדרושים לבניית מאגרי מידע דמויי CoSMoS.


שאלות בתשובה חופשית ותשובות לדוגמא של תלמידים

תגובות התלמידים הבאות מבחינת ביולוגיה של AP בשנת 2013 מנוגדות לתגובות מקובלות ותגובות לא שלמות. בדוגמה הראשונה, הסטודנט מקבל קרדיט מלא (4 נקודות) מכיוון שהתגובה לחלק (א) כוללת הסברים סבירים הקושרים שינויים ברצפי חומצות אמינו לשינויים במבנה הפוליפפטיד המיוצר, ובחלק (ב) התלמיד משתמש בבירור בראיות כדי לחבר ולהצדיק תחזית למושג ביולוגי גדול יותר (כלומר, הקשר בין מבנה לתפקוד). בדוגמה השנייה, לא ניתן להעניק נקודות עבור חלק (א) מכיוון שהתלמיד אינו מספק הסבר מניח את הדעת לתופעות שנצפו, אולם, התלמיד זוכה ב-2 נקודות בחלק (ב) על ביצוע חיזוי תקף ומתן הצדקה או נימוק המקשרים בין חיזוי למושג ביולוגי (כלומר, הקשר בין מבנה לתפקוד).

שאלה בתגובה חופשית:

הטבלה שלהלן מציגה את רצף חומצות האמינו של הקטע הקרבוקסילי-מסופי של פוליפפטיד משומר מארבעה מינים שונים, אך קשורים. כל חומצת אמינו מיוצגת על ידי קיצור בן שלוש אותיות, ושאריות חומצות האמינו בשרשרות הפוליפפטיד ממוספרים מקצה חומצת האמינו ועד לקצה הקרבוקסיל. תאים ריקים מצביעים על כך שאין חומצת אמינו.

  1. בהנחה שמין I הוא זן האבות של הקבוצה, להסביר השינוי הגנטי הסביר ביותר שהפיק את הפוליפפטיד במינים II והשינוי הגנטי הסביר ביותר שהפיק את הפוליפפטיד במינים III.
  2. לנבא ההשפעות של המוטציה על המבנה והתפקוד של החלבון שנוצר במין IV. לְהַצְדִיק התחזית שלך.

כּוֹתֶרֶת

חלק (א): נקודה אחת לשורה לכל היותר 2 נקודות להסבר השינויים הגנטיים הסבירים ביותר שהניבו את הפוליפפטידים במינים II ומינים III.

מִין שינוי גנטי ב- DNA/בסיסים תוצאה של שינוי לפוליפפטיד/חלבון
II מוטציה/החלפה/מוטציה נקודתית/מוטציית missense שינוי חומצת אמינו רק במיקום 4 (Val to Lys)
III מוטציה (למשל, החלפה/הכנסה/מחיקה/מוטציה נקודתית/מוטציה של מסגרת/מוטציה שטויות) המציגה קודון עצירה לאחר הקודון עבור Val סיום הפוליפפטיד לאחר הוואל במיקום 8

חלק (ב): נקודה אחת לכל חיזוי סביר לגבי השפעות המוטציה על המבנה והתפקוד של החלבון שנוצר במין IV, ונקודה אחת להצדקת התחזית ל-2 נקודות מקסימום.

שינוי צפוי
(מקסימום נקודה אחת)
הצדקה של חיזוי
(מקסימום נקודה אחת)
חלבון עשוי להיות בעל מבנה שונה ושינוי בתפקודו. שינוי ברצף חומצות האמינו של החלבון החל מעמדה 5 עלול לשנות את המבנה הכללי או את האזורים המבניים המקומיים, ולהפריע לתפקוד החלבון.
לחלבון עשוי להיות מבנה שונה וללא שינוי בתפקוד. שינוי ברצף חומצות האמינו משנה את הצורה/קונפורמציה/קיפול/אזור מקשר/אזור מווסת של החלבון, אך אינו משפיע על האזור(ים) התפקודיים הקריטיים של החלבון.
מבנה החלבון ותפקודו עשויים שלא להיות מושפעים. שינוי ברצף חומצות אמינו אינו משנה את צורת החלבון/קונפורמציה/קיפול ואינו משנה את התפקוד.

מדגם תלמיד 1: הוענק 4 נקודות

תלמיד זה זכה במספר הנקודות המקסימלי (4).

התגובה הרוויחה נקודה אחת בחלקה (א) על ההסבר כי השינוי הגנטי הסביר ביותר במין II היה מוטציה נקודתית בה משתנה נוקלאוטיד יחיד, וחומצת האמינו שאליה מקודדים השתנתה.

התגובה הרוויחה נקודה אחת בחלקה (א) על ההסבר כי השינוי הגנטי הסביר ביותר במינים השלישי היה מוטציה נקודתית שקידדה קודון STOP, מה שעצר את ייצור הפוליפפטיד בטרם עת.

התגובה הרוויחה נקודה אחת בחלק (ב) לחיזוי שמוטציה של שינוי מסגרת במין IV גורמת למבנה חלבונים שונה בהרבה ולתפקוד חלבון שונה בתכלית.

התגובה הרוויחה נקודה אחת בחלק (ב) על נימוק התחזית בכך ששרשרת הפוליפפטיד השתנתה לחלוטין, דבר ששינה את האינטראקציות בין חומצות האמינו של החלבון וגרם לתפקוד החלבון.

מדגם תלמיד 2: הוענק 2 נקודות

התלמיד הרוויח 2 נקודות לתגובה זו.

התלמיד זכה ב-0 נקודות עבור חלק (א) מכיוון שהתגובה לא כללה הסברים סבירים לשינויים הגנטיים הסבירים ביותר שיצרו את רצפי הפוליפפטידים במינים II ובמיני III.

התגובה הרוויחה נקודה אחת בחלק (ב) לחיזוי המבנה והתפקוד של החלבון במינים הרביעי ישתנו באופן משמעותי.

התגובה הרוויחה נקודה אחת בחלק (ב) להצדקת התחזית בכך שקבע כי שינוי מבני ופונקציונלי בחלבון נובע משינויים בסדר התוכן וחומצות האמינו שלו.


התחל בקישור לדף הבית של NCBI. בחר פיצוץ. With your new knowledge of Sequence Searching and BLAST, let's begin with a sequence you make up and then your וולבכיה סדר פעולות.

  • בחר nucleotide BLAST under the basic BLAST category.
  • Input your own nucleotides (A,T,G,C) that fill one complete line into the Search Box. This is referred to as the query sequence.
  • VERY IMPORTANT - Click on the circlefor 'Others (nr etc.) under Choose Search Set
  • בחר BLAST! at end of page. A new window appears.
  • Wait for the results page to automatically launch. The wait time depends on the type of search you are doing and how many other researchers are using the NCBI website at the same time you are!
  1. Did your fake sequence produce a significant hit? (probably not since a significant hit is below E-10 usually)If yes, how many?
  2. How many sequences did it search in the database?
  3. How many nucleotide letters did it search in the database?
    • Select Home at the top of the BLAST page
    • Select nucleotide BLAST under the Basic BLAST category
    • הכנס את וולבכיה sequence below into the Search box. (At this point in the lab, if you generated your own וולבכיה sequences, you can BLAST your own sequence. Here everyone will BLAST the same sequence provided to you below).
    • Your Wolbachia Sequence: GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATT AATAAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCT GAAAAACCATTAAACGCTGCGATAGCAAGCATCTTTGCACAGAGTTGTTCTCAATGTAACGATAAA GTTGGTGATGGTACAACAACGTGCTCAATACTAACTAGCAACATGATAATGGAAGCTTCAAAATCA ATTGCTGCTGGAAACGATCGTGTTGGTATTAAAAACGGAATACAGAAGGCAAAAGATGTAATATTA AAGGAAATTGCGTCAATGTCTCGTACAATTTCTCTAGAGAAAATAGACGAAGTGGCACAAGTTGCA ATAATCTCTGCAAATGGTGATAAGGATATAGGTAACAGTATCGCTGATTCCGTGAAAAAAGTTGGA AAAGAGGGTGTAATAACTGTTGAAGAGAGTAAAGGTTCAAAAGAGTTAGAAGTTGAGCTGACTACT GGCATGCAATTTGATCGCGGTTATCTCTCTCCGTATTTTATTACAAATAATGAAAAAATGATCGTG GAGCTTGATAATCCTTATCTATTAATTACAGAGAAAAAATTAAATATTATTCAACCTTTACTTCCT ATTCTTGAAGCTATTGTTAAATCTGGTAAACCTTTGGTTATTATTGCAGAGGATATCGAAGGTGAA GCATTAAGCACTTTAGTTATCAATAAATTGCGTGGTGGTTTAAAAGTTGCTGCAGTAAAAGCTCCA GGTTTTGGTGACAGAAGAAAGGAGATGCTCGAAGACATAGCAACTTTAACTGGTGCTAAGTACGTC ATAAAAGATGAACTT
    • בחר BLAST! A new window appears
    • בחר Format! and you will have to wait for the results page to appear.
  4. How long (query length) is the וולבכיה sequence that you used to search the database?
  5. What is the E-value and bit score of the best hit (in this case, the first matching sequence)?
  6. What is the most likely identity of this sequence? (click on the blue link to the left of the top hit) What is the title of the scientific publication that reported this sequence (click on the PUBMED 16267140 link)
    • Go back twice when you're done.
    • Select Home at the top of the BLAST page.
    • Select nucleotide BLAST under the Basic BLAST category.
    • Now enter only the first 135 base pairs of your Wolbachia sequence below into the Search box.
    • שֶׁלְךָ וולבכיה Sequence GTTGCAGCAATGGTAGACTCAACGGTAGCAATAACTGCAGGACCTAGAGGAAAAACAGTAGGGATT AATAAGCCCTATGGAGCACCAGAAATTACAAAAGATGGTTATAAGGTGATGAAGGGTATCAAGCCTGAA
  7. What do you observe about the E-values? What is the E-value and score of the best hit (the first matching sequence)?
  8. Is the identity of the best hit different from when you used the complete nucleotide sequence? Is it the same gene as identified before?
  9. From the two BLAST searches, what can you deduce about how the length of a query sequence affects your confidence in the sequence search?
    • Close all web windows. This exercise is now complete. You successfully mastered one of the state-of-the-art tools used by most molecular and evolutionary biology researchers today. There is a lot of information on the NCBI website. Feel free to explore the website and you can find more tutorials at: http://www.ncbi.nlm.nih.gov/guide/training-tutorials/

דִיוּן

Our results indicate that while, in general, interactions at the node (protein) level are conserved at low rates, interactions within modules are conserved to a much greater degree. This raises the intriguing possibility that interactions are conserved on a level different from that of the individual genes. In other words, while there is a strong selective pressure to maintain interactions within a module, there is less pressure to maintain between-module interactions.

The within-module conservation statistics that are presented in this study are probably an underestimate for the real conservation rates due to the incompleteness of interaction data [9]. Our results are robust with respect to varying the amount of available data (and coverage), when compared to random interaction networks, across all four species we studied. Many of the modules we discover independently in each species are significantly conserved across more than one species, and we expect this number to grow once additional data becomes available. This refined understating of conservation may lead to better cross species search tools that can utilize the network context in addition to sequence similarity.

Our results also shed new light on some recent discoveries about the relationships between genes associated with very different phenotypic outcomes in close species [36]. The results suggest that while modules are conserved, interactions between modules may change at a higher pace, allowing modules involved in a specific function in one species to become involved in a different function in another species through interactions with other modules.

A possible analogy to our proposed view for module conservation is sequence conservation (Figure 5). When looking at the sequence similarity between close species, we see that the overall similarity is lower than the similarity of the coding regions, as there is less evolutionary pressure to preserve intergenic regions. Similarly, the overall network similarity is lower than the similarity of the modules, as there is less evolutionary pressure to preserve between-modules interactions. There are also cases where some nucleotide substitutions in coding regions result in functionally similar proteins (e.g., synonymous mutations or mutations that retain the physical properties of the amino acids). Likewise, changes in within-module interactions can result in functionally similar modules, and can be explained by redundancy or indirect interactions via a third protein, as long as the two proteins remain in the same module. This network organization structure allows both robustness (as modules often stay the same across species) and flexibility (by changing the interactions between modules) which may confer advantages in evolving species.

Module conservation is analogous to sequence conservation. For sequences (left) coding regions are usually much more conserved than the genome as a whole. Similarly, in the network setting, modules are more conserved than the entire network. In addition, coding regions can often tolerate synonymous mutations that change the DNA sequence itself but do not alter the protein product. Similarly, modules may be able to tolerate loss of specific interactions as long as the two interacting orthologs remain in the same module (often through redundant interactions or interactions with other module members).


MultiGeneBlast: Combined BLAST searches for operons and gene clusters

MultiGeneBlast is an open source tool for identification of homologs of multigene modules such as operons and gene clusters. It is based on a reformatting of the FASTA headers of NCBI GenBank protein entries, using which it can track down their source nucleotide and coordinates.

Oftentimes when studying such genetic loci, much can be learned from their evolutionary context. Furthermore, MultiGeneBlast can aid in the detection of such multigene parts for synthetic biology projects a synthetic library of operons can be created based on its output to identify those operons whose function is closest to the one desired by the user.

This tool provides the opportunities to identify all homologous genomic regions by combining the results of single BlastP runs on each gene, and sorting genomic regions from any GenBank entry by the number of hits, synteny conservation and cumulative Blast bit score. The basic algorithm behind this was previously used in our antiSMASH software.
Additionally, architecture searches can be performed to find any genomic regions with Blast hits to any user-specified combination of amino acid sequences.

The tool comes with a pre-configured database containing the most recent version of all relevant GenBank divisions. Moreover, you can easily make your own databases from local files or online GenBank entries or divisions.

First full versions for Windows, Mac OS X and Linux are now available from the download area.


ניתוח DNA של סנגר

תכונות הניתוחים הנרחבות של Sequencher הן הבסיס שעליו נבנתה. להתאמה אישית מההתחלה ועד הסוף אין תוכנה אחרת שמציעה לך כוח רב כמו Sequencher. עם ממשק קל לשימוש שחודד במשך 25 שנים, משתמשים בפעם הראשונה ירגישו כמו מקצוענים תוך דקות. הכל החל מקריאות חיתוך, אלגוריתמי הרכבה ויישור מותאמים אישית, טבלאות וריאציות, דוחות סיכום, הערות, הרשימה נמשכת ונמשכת. בואו לראות מדוע Sequencher פורסם בעשרות אלפי מאמרי מחקר, ובכתבי עת שנבדקו עמיתים. כוח בפשטות.