מֵידָע

האם snRNA יוצאים מהגרעין או לא?

האם snRNA יוצאים מהגרעין או לא?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ב ביולוגיה מולקולרית של התא (Alberts, et al., 2015), הוא מפרט את ה-RNAs השונים שמועברים דרך קומפלקס הנקבוביות הגרעיניות (NPC) לתוך הציטופלזמה.

הרשימה כוללת snRNA, אבל ראיתי שצוין במקום אחר ש-snRNA לא עוזבים את הגרעין, שהם נוצרים שם וממלאים את תפקידם שם.

האם הגרסה של MBOC נכונה ו-snRNAs עוזבים את הגרעין, או שמא שאר המקורות נכונים וה-snRNAs נוצרים, נשארים ומתפקדים בגרעין?


לאחר שעתוק של כמה UsnRNAs, ה-RNAs עוזבים תחילה את הגרעינים. לאחר הרכבה של חלבונים שונים ושינוי על הרנ"א בציטוזול, הרנ"א חוזרים לגרעינים. בנוסף, הוכח ש-U6snRNP בוגר עובר בין שברים גרעיניים וציטוסוליים בשמרים, אם אני זוכר נכון.

http://openi.nlm.nih.gov/detailedresult.php?img=2582628_gkn658f1&req=4


תפקידם של גורמי מארח בסחר תת-תאי של חלבוני גאג ו-RNA גנומי המובילים להרכבת Virion

Eunice C. Chen, Leslie J. Parent, ב-Retrovirus-Cell Interactions, 2018

יצוא גרעיני של Spumaretrovirus RNA

ייצוא גרעיני של הגנום הנגיפי ב-spumaretroviruses, כגון אב-טיפוס foamy virus (PFV), משתמש במנגנון שהוא שילוב של זה של רטרו-וירוסים פשוטים ומורכבים (איור 8.1). ייצוא גרעיני ב-PFV תלוי ב-Crm1, כפי שמעידה על ירידה בביטוי Gag בתאי 293T זיהומיים שעברו פרו-וירוס בעקבות טיפול בלפטומיצין B (LMB) (Bodem et al., 2011). עם זאת, PFV אינו מקודד לחלבון ויראלי המקיים אינטראקציה עם Crm1. במקום זאת, PFV מסתמך על חלבון קושר RNA תאי HuR וחלבוני מתאם ANP32A/B כדי לגשר על האינטראקציה בין הגנום הנגיפי ל-Crm1. מאמינים שאינטראקציה זו היא אינטראקציה ישירה, שכן היא זוהתה על ידי חיבור צולב של חלבון RNA וטכניקות משקעים אימונו בין הגנום הנגיפי לבין חלבונים מתויגים. עם זאת, המנגנונים של אינטראקציה זו אינם מובהרים במלואם, שכן מבנה ה-RNA המשני הנדרש בדרך כלל לאינטראקציות HuR-RNA לא זוהה ב-PFV RNA (Bodem et al., 2011 Prechtel et al., 2006).


ביוגנזה של snRNPs spliceosomal

למעט U6, ה-snRNAs ה-spliceosomal העיקריים (U1, U2, U4 ו-U5) מסונתזים על ידי Pol II. ה-snRNAs הספציפיים ל-Pol-II רוכשים מבנה כובע מונומתיל גואנוזין (7mGpppG) והתמלילים העיקריים שלהם נמשכים הרבה מעבר לקצה 3' של ה-RNA הבוגר. תוצרי ביניים יציבים של פרה-snRNA הנושאים רק ספיכה קצרה (5-10 nt) של 3' נוצרים על ידי אירוע עיבוד מקושר שעתוק הדורש רצף אותות הפועל ב-cis (תיבה 3') וזרחון של התחום C-terminal של תת-היחידה הגדולה ביותר של Pol II (Medlin et al., 2003). ה-presnRNA מורכב לקומפלקס יצוא גדול הכולל את קומפלקס 7mG-cap-binding (CBC), המתאם הפוספוריל ליצוא RNA (PHAX) ואת קומפלקס CRM1/RanGTP. לאחר ייצוא לציטופלזמה דרך קומפלקס הנקבוביות הגרעיניות (NPC), דה-פוספורילציה של הידרוליזה של PHAX ו-GTP של Ran גורמת לפירוק של קומפלקס הייצוא snRNA (Ohno et al., 2000).

בציטופלזמה, ההישרדות של קומפלקס חלבון נוירונים מוטוריים (SMN) מקלה על הרכבה של קדם-snRNA עם טבעת הטרוהפטאמרית של שבעה חלבוני Sm - B/B′, D1, D2, D3, E, F ו-G - ליצירת קומפלקס הליבה של snRNP (Paushkin et al., 2002). חלבוני Sm נקשרים לאתר הקישור Sm שמור (Sm, consensus RAUU U /GUUGR) של snRNAs spliceosomal ספציפיים ל-Pol-II. קשירה של חלבוני Sm היא תנאי מוקדם להיפר-מתילציה של מכסה 7mG ל-2,2,7-trimethylguanosine (TMG) על ידי Tgs1 methyltransferase, כמו גם להסרה אקסונוקליאוליטית של רצפי הקרוואן 3'. כובע TMG המסונתז החדש וחלבוני Sm הקשורים מספקים את אות הלוקליזציה הגרעיני עבור snRNP הליבה הציטופלזמית. יבוא מחדש של Sm snRNPs לגרעין מתווך על ידי שלושה גורמים: snurportin-1 (SPN1), המזהה את מכסת ה-TMG של ה-snRNA importin β, המתחבר ל-SPN1 ולקולטן יבוא לא מזוהה המקיים אינטראקציה עם חלבוני Sm (Sm IR) ( Palacios et al., 1997).

לאחר כניסה מחדש לנוקלאופלזמה, חלבוני הייבוא ​​מתנתקים וה-snRNPs החדשים שיובאו מצטברים באופן חולף בגופי Cajal (Sleeman and Lamond, 1999). בגוף Cajal, U1, U2, U4 ו-U5 snRNAs עוברים פסאודורידילציה ספציפית לאתר (Ψ) ו-2'-O-methylation (m) המכוונות על ידי scaRNA, המצטברים באופן ספציפי בגופי Cajal (Jády et al., 2003) . בנוסף לחלבוני הליבה Sm הנפוצים, snRNPs U1, U2, U4 ו-U5 הבוגרים מכילים גם חלבוני RNP ספציפיים למין. מכיוון שנראה שהחלבונים הספציפיים ל-snRNP מתרכזים בגופי Cajal, מאמינים שהם קשורים ל-snRNPs ליבה באברון זה.

לבסוף, snRNPs spliceosomal בוגרים מצטברים באזור האינטרכרומטין במבנים הנקראים כתמי שחבור. בדרך כלל, כתמים ממוקמים קרוב לגנים המתועתקים באופן פעיל. הם כנראה מספקים אתרי אחסון עבור snRNPs או מתפקדים במחזור snRNP (Lamond and Spector, 2003). חשוב לציין שמספר מעבדות דיווחו על רמות נמוכות של לוקליזציה גרעינית של Sm snRNPs בתנאים שונים (Gerbi et al., 2003 Sleeman and Lamond, 1999). לרוע המזל, החשיבות התפקודית של הצטברות חולפת של Sm snRNAs בגרעין נותרת השערה. ביוגנזה של U11, U12 ו-U4atac מינור spliceosomal snRNPs הספציפיים ל-Pol-II עוקבת כנראה אחר מסלול ההבשלה של snRNPs Sm Major.

בניגוד ל-Sm snRNAs הספציפיים ל-Pol-II, הביוגנזה של ה-snRNA U6 המתועתק ב-Pol-III מוגבלת לגרעין. לפני הצטברות כתמי השחבור הנוקלאופלזמיים, ה-U6 snRNA מתבגר מבקר בגרעין ובגוף הקאג'ל. סינתזה של U6 snRNA מסתיימת בתוך מתיחה קצרה של U המשמשת כאות סיום שעתוק עבור Pol III. מתיחה U 3′-טרמינלית של RNA U6 שסונתז זה עתה מתחברת באופן חולף לחלבון La, המספק יציבות ל-RNA המתהווה ומקל על הרכבת snRNP (Wolin and Cedervall, 2002). מאוחר יותר, החלבון La מוחלף בהטרומר דמוי הסופגנייה של שבעה חלבונים דמויי Sm (Lsm2, Lsm3, Lsm4, Lsm5, Lsm6, Lsm7 ו-Lsm8) (Achsel et al., 1999). המבנה של טבעת Lsm עדיין לא ידוע.

במהלך הבשלתו, ה-U6 snRNA עובר גם פסאודורידילציה ספציפית לאתר ו-2'-O-methylation. עם זאת, בניגוד ל-Sm snRNAs, אשר משתנים על ידי scaRNPs בגוף Cajal, מתילציה של 2'-O וכנראה גם פסאודורידילציה של ה-U6 snRNA מכוונת על ידי snoRNA, השוכנים בגרעין. זה מצביע על כך ש-U6 עובר במחזוריות דרך הגרעין כדי לעבור שינויים בתיווך של snoRNA (Ganot et al., 1999 Lange and Gerbi, 2000). קישור של קומפלקס החלבון Lsm חיוני למיקוד של U6 snRNA לגרעין ולאחר מכן לגוף Cajal (Gerbi and Lange, 2002). U6 ו-U4 snRNPs הבוגרים קיימים ב- U4-U6 disnRNP משותף שגם קושר את U5 snRNP ליצירת U4-U6-U5 tri-snRNP. הממצא האחרון ש-SART3/p110, גורם חלבוני המקל על הרכבת U4-U6, מרוכז בגוף Cajal מציע שהרכבה של U4-U6 snRNP עשויה להתבצע באברון זה (Stanek et al., 2003). לא ברור אם U5 snRNP מצטרף ל-U4-U6 di-snRNP בגוף Cajal או מאוחר יותר בנוקלאופלזמה. ה-snRNA הבוגר של U6 נושא מבנה כובע γ-monomethylphosphate (mpppG) (Singh and Reddy, 1989), אך עדיין לא ידוע באיזה שלב של ביוגנזה של U6 כובע mpppG מסונתז.


הפניות

Golgi, C. Sur la structure des cellules nerveuses. קֶשֶׁת. איטל. ביול. 30, 60–71 (1898).

Cajal, S. R. y. Un sencillo methodo de coloracion seletiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos de vertebrados e invertebrados. טראב. מַעבָּדָה. להשקיע. ביול. (מדריד) 2, 129–221 (1903).

Gall, J.G., Bellini, M., Wu, Z. & Murphy, C. Assembly of the nuclear transcription and processing machines: Cajal bodies (coiled bodies) and transcriptosomes. מול. ביול. תָא 10, 4385–4402 (1999).

Jörgensen, M. & Zellenstudien, I. Morphologische Beiträge zum Problem des Eiwachstums. קֶשֶׁת. זלפורש. 10, 1–126 (1913).

Bier, K., Kunz, W. & Ribbert, D. Struktur und Funktion der Oocytenchromosomen und Nukleolen sowie der Extra-DNS while der Oogenese panoistischer und meroistischer Insekten. כרומוזומה 23, 214–254 (1967).

Gall, J.G. כרומוזומים מברשת מגרעיני ביציות של הטריטון. ג'יי מורפול. 94, 283–352 (1954).

Callan, H. G. עבודה אחרונה על מבנה גרעיני התא. ב מבנה יפה של תאים: סימפוזיון של הקונגרס השמיני בביולוגיה של התא, ליידן 1954, הוצאת האיגוד הבינלאומי למדעי הביולוגיה, סדרה ב' 21, 89–109 (1954).

Gall, J. G., Stephenson, E. C., Erba, H. P., Diaz, M. O. & Barsacchi-Pilone, G. הגנים של היסטון ממוקמים בלוקוסי הכדור של כרומוזומי מברשת ניוט. כרומוזומה 84, 159–171 (1981).

Callan, H. G., Gall, J. G. & Murphy, C. הגנים של היסטון ממוקמים בלוקוסי הכדור של קסנופוס כרומוזומי מברשת מנורה. כרומוזומה 101, 245–251 (1991).

Gall, J. G. & Callan, H. G. אברון הכדור מכיל ריבונוקלאופרוטאין גרעיני קטן. פרוק. Natl Acad. Sci. ארה"ב 86, 6635–6639 (1989).

Wu, Z., Murphy, C., Callan, H. G. & Gall, J. G. ריבונוקלאופרוטאין גרעיני קטן וריבונוקלאופרוטאין גרעיני הטרוגניים בשלפוחית ​​הנבט הדו-חיים: לולאות, כדורים וסנורפוזומים. J. Cell Biol. 113, 465–483 (1991).

Wu, C. -H. H. & Gall, J.G. U7 RNA גרעיני קטן ב-C snurposomes של קסנופוס שלפוחית ​​נבט. פרוק. Natl Acad. Sci. ארה"ב 90, 6257–6259 (1993).

Wu, C. -H. H., Murphy, C. & Gall, J. G. אתר הקישור Sm מכוון U7 snRNA לגופים מפותלים (כדורים) של ביציות דו-חיים. RNA 2, 811–823 (1996).

Frey, M. R. & Matera, A. G. גופים מפותלים מכילים RNA גרעיני קטן מסוג U7 ומתקשרים עם רצפי DNA ספציפיים בתאים אנושיים בין-פאזיים. פרוק. Natl Acad. Sci. ארה"ב 92, 5915–5919 (1995).

Monneron, A. &. Bernhard, W. ארגון מבני עדין של גרעין הבין-פאזי בחלק מתאי יונקים. J. Ultrastruct. מילון 27, 266–288 (1969).

Hardin, J. H., Spicer, S. S. & Greene, W. B. המבנה הפרנוקליאולרי, גוף העזר של Cajal, כרומטין מין ומבנים קשורים בגרעיני נוירונים טריגמינליים של חולדה: מחקר ציטוכימי ואולטרה-סטרוקטורלי. ענת. Rec. 164, 403–432 (1969).

Lafarga, M. & Hervas, J. P. in תרומתו של רמון אי קחאל למדעי המוח (עורכים Grisolia, S., Guerri, C., Samson, F., Norton, S. & Reinoso-Suárez, F.) 91–100 (Elsevier Science Publishers, 1983).

Fakan, S., Leser, G. & Martin, T. E. הפצה אולטרה-סטרוקטורלית של ריבונוקלאופרוטאין גרעיני כפי שהוצגה על ידי אימונוציטוכימיה על חתכים דקים. J. Cell Biol. 98, 358–363 (1984).

Lafontaine, J.G. מחקר מיקרוסקופ אור ואלקטרונים של גופים גרעיניים כדוריים קטנים בתאים מריסטמטיים של Allium cepa, וויסיה פאבה, ו רפנוס סאטיבוס. J. Cell Biol. 26, 1–17 (1965).

Chamberland, H. & Lafontaine, J. G. לוקליזציה של אנטיגנים snRNP בגופים הקשורים לגרעין: מחקר של גרעינים בין-פאזיים צמחיים על ידי מיקרוסקופיה קונפוקאלית ואלקטרונים. כרומוזומה 102, 220–226 (1993).

Ras̆ka, I. et al. מחקרים אימונולוגיים ואולטרה-סטרוקטורליים של הגוף המפותל הגרעיני עם נוגדנים אוטואימוניים. Exp. Res Res. 195, 27–37 (1991).

Andrade, L. E. C. et al. נוגדן עצמי אנושי לחלבון חדש של הגוף המפותל הגרעיני: אפיון אימונולוגי ושיבוט cDNA של p80-coilin. ג 'אקספ. Med. 173, 1407–1419 (1991).

Beven, A. F., Simpson, G. G., Brown, J. W. S. & Shaw, P. J. הארגון של רכיבים spliceosomal בגרעינים של צמחים גבוהים יותר. J. Cell Sci. 108, 509–518 (1995).

Tuma, R. S., Stolk, J. A. & Roth, M. B. זיהוי ואפיון של חלבון אברון כדור. J. Cell Biol. 122, 767–773 (1993).

Wu, Z., Murphy, C. & Gall, J. G. Human p80-coilin מכוון לאברוני כדור בשלפוחית ​​הנבט הדו-חיים. מול. ביול. תָא 5, 1119–1127 (1994).

Gall, J. G., Tsvetkov, A., Wu, Z. & Murphy, C. האם אברון הכדור/גוף המפותל הוא מרכיב גרעיני אוניברסלי? Dev. ג'נט. 16, 25–35 (1995).

Bauer, D. W. & Gall, J. G. גופים מפותלים ללא סליל. מול. ביול. תָא 8, 73–82 (1997).

Tucker, K. E. et al. גופי Cajal שיוריים בעכברי נוק-אאוט של סליל אינם מצליחים לגייס Sm snRNPs ו-SMN, המוצר של גן ניוון שרירי עמוד השדרה. J. Cell Biol. 154, 293–307 (2001).

בליני, מ' קוילין, יותר מסמן מולקולרי של הגוף הקאג'ל (המפותל). מאמרים ביו 22, 861–867 (2000).

Carmo-Fonseca, M. et al. גרעיני יונקים מכילים מוקדים המועשרים מאוד ברכיבים של מכונות השחבור שלפני ה-mRNA. EMBO J. 10, 195–206 (1991).

Carmo-Fonseca, M., Pepperkok, R., Carvalho, M. T. & Lamond, A. I. קולוקליזציה תלוית תעתיק של U1, U2, U4/U6 ו-U5 snRNPs בגופים מפותלים. J. Cell Biol. 117, 1–14 (1992).

Huang, S. & Spector, D.L. U1 ו-U2 RNAs גרעיניים קטנים נמצאים בכתמים גרעיניים. פרוק. Natl Acad. Sci. ארה"ב 89, 305–308 (1992).

Matera, A. G. & Ward, D. C. ארגון נוקלאופלזמי של ריבונוקלאופרוטאין גרעיני קטן בתאים אנושיים מתורבתים. J. Cell Biol. 121, 715–727 (1993).

Lamond, A. I. & Earnshaw, W. C. מבנה ותפקוד בגרעין. מַדָע 280, 547–553 (1998).

Matera, A. G. גופים גרעיניים: תת-תחומים מרובי פנים של מרחב האינטרכרומטין. מגמות תא ביול. 9, 302–309 (1999).

Gall, J. G. Cajal bodies: 100 השנים הראשונות. אננו. Rev. Cell Dev. ביול. 16, 273–300 (2000).

Liu, Q. & Dreyfuss, G. מבנה גרעיני חדש המכיל את ההישרדות של חלבון נוירונים מוטוריים. EMBO J. 15, 3555–3565 (1996).

Schul, W. et al. גורמי המחשוף של RNA 3′ CstF 64 kDa ו-CPSF 100 kDa מרוכזים בתחומים גרעיניים הקשורים באופן הדוק לגופים מפותלים ול-RNA שסונתז לאחרונה. EMBO J. 15, 2883–2892 (1996).

Schul, W., van Driel, R. & de Jong, L. Coiled bodies וגנים U2 snRNA הסמוכים לגופים מפותלים מועשרים בגורמים הנדרשים לשעתוק snRNA. מול. ביול. תָא 9, 1025–1036 (1998).

Darzacq, X. et al. RNAs גרעיניים קטנים ספציפיים לגוף הקאג'ל: מחלקה חדשה של 2′-או-מתילציה ופסאודורידילציה מנחים RNAs. EMBO J. 21, 2746–2756 (2002).

Richard, P. et al. מוטיב רצף משותף קובע את הלוקליזציה הספציפית לגוף Cajal של scaRNAs של תיבת H/ACA. EMBO J. 22, 4283–4293 (2003).

Jády, B. E. & Kiss, T. RNA מדריך גרעיני קטן מתפקד גם ב-2′-אומתילציה של ריבוז ופסאודורידילציה של ה- U5 spliceosomal RNA. EMBO J. 20, 541–551 (2001).

Samarsky, D. A., Fournier, M. J., Singer, R. H. & Bertrand, E. מוטיב ה-snoRNA box C/D מכוון מיקוד גרעיני וגם משלב סינתזה ולוקליזציה של snoRNA. EMBO J. 17, 3747–3757 (1998).

Carvalho, T. et al. תוצר הגן של מחלת ניוון שרירי השדרה, SMN: קשר בין ביוגנזה של snRNP לגוף הקאג'ל (המפותל). J. Cell Biol. 147, 715–727 (1999).

Narayanan, A., Speckmann, W., Terns, R. & Terns, M. P. תפקידו של מוטיב הקופסה C/D בלוקליזציה של RNAs גרעיניים קטנים לגופים מפותלים ולנוקלאולים. מול. ביול. תָא 10, 2131–2147 (1999).

Sleeman, J. E. & Lamond, A. I. snRNPs שנאספו לאחרונה מתחברים לגופים מפותלים לפני כתמים, דבר המצביע על מסלול הבשלה של snRNP גרעיני. Curr. ביול. 9, 1065–1074 (1999).

Handwerger, K.E., Murphy, C. & Gall, J.G. דינמיקה במצב יציב של רכיבי גוף Cajal ב- קסנופוס שלפוחית ​​נבט. J. Cell Biol. 160, 495–504 (2003).

Sleeman, J. E., Trinkle-Mulcahy, L., Prescott, A. R., Ogg, S. C. & Lamond, A. I. חלבוני הגוף של Cajal SMN ו-coilin מראים התנהגות דינמית דיפרנציאלית in vivo. J. Cell Sci. 116, 2039–2050 (2003).

Boudonck, K., Dolan, L. & Shaw, P. J. התנועה של גופים מפותלים המוצגת בתאי צמחים חיים על ידי החלבון הפלורסנטי הירוק. מול. ביול. תָא 10, 2297–2307 (1999).

Platani, M., Goldberg, I., Swedlow, J. R. & Lamond, A. In vivo ניתוח של תנועת גוף קאג'ל, הפרדה והצטרפות בתאים אנושיים חיים. J. Cell Biol. 151, 1561–1574 (2000).

Platani, M., Goldberg, I., Lamond, A. I. & Swedlow, J. R. Cajal דינמיקת הגוף והקשר עם כרומטין תלויים ב-ATP. Nature Cell Biol. 4, 502–508 (2002).

Verheggen, C. et al. snoRNPs של יונקים ושמרים U3 מתבגרים בתאים גרעיניים ספציפיים וקשורים. EMBO J. 21, 2736–2745 (2002).

Jády, B.E. et al. שינוי של RNAs גרעיני קטן Sm מתרחש בגוף הקאג'ל הנוקלאופלזמי בעקבות יבוא מהציטופלזמה. EMBO J. 22, 1878–1888 (2003).

Verheggen, C. et al. תיבה C/D סחר ב-RNA גרעיני קטן כולל חלבוני RNP גרעיניים קטנים, גורמים גרעיניים ותחום גרעיני חדש. EMBO J. 20, 5480–5490 (2001).

Meister, G. & Fischer, U. בסיוע בהרכבת RNP: מתחמי SMN ו-PRMT5 משתפים פעולה ביצירת UsnRNPs spliceosomal. EMBO J. 21, 5853–5863 (2002).

Pellizzoni, L., Yong, J. & Dreyfuss, G. תפקיד חיוני למתחם SMN בספציפיות של הרכבת snRNP. מַדָע 298, 1775–1779 (2002).

Hebert, M. D., Szymczyk, P. W., Shpargel, K. B. & Matera, A. G. Coilin יוצר את הגשר בין Cajal bodies ו-SMN, חלבון ניוון שרירי עמוד השדרה. Genes Dev. 15, 2720–2729 (2001).

Cajal, S. R. y. El nucleo de las células piramidales del cerebro humano y de algunos mamiferos. טראב. מַעבָּדָה. להשקיע. ביול. Univ. מדריד 8, 27–62 (1910).

Bellini, M. & Gall, J. G. Coilin יכולים ליצור קומפלקס עם הריבונוקלאופרוטאין הגרעיני הקטן U7. מול. ביול. תָא 9, 2987–3001 (1998).

Smith, K. P., Carter, K. C., Johnson, C. V. & Lawrence, J.B. U2 ו-U1 snRNA לוקוסים של גנים קשורים לגופים מפותלים. ג 'סל. Biochem. 59, 473–485 (1995).

Zhu, Y., Tomlinson, R. L., Lukowiak, A. A., Terns, R. M. & Terns, M. P. Telomerase RNA מצטבר בגופי Cajal בתאי סרטן אנושיים. מול. ביול. תָא 3 אוקטובר 2003 [עברית לפני ההדפסה].


תלונת DMCA

אם אתה סבור שתוכן זמין באמצעות האתר (כפי שמוגדר בתנאי השירות שלנו) מפר זכויות יוצרים אחת או יותר שלך, אנא הודע לנו על ידי מתן הודעה בכתב ("הודעת הפרה") המכילה את המידע המתואר להלן לגורמים המיועדים לכך. סוכן המפורט להלן. אם מורי ורסיטי ינקוט פעולה בתגובה להודעת הפרה, היא תעשה ניסיון בתום לב ליצור קשר עם הצד שהעמיד תוכן כזה לזמין באמצעות כתובת הדוא"ל העדכנית ביותר, אם בכלל, שסופקה על ידי גורם כזה למורים של ורסיטי.

הודעת ההפרה שלך עשויה להיות מועברת לגורם שהפך את התוכן לזמין או לצדדים שלישיים כגון ChillingEffects.org.

לידיעתך, אתה תהיה אחראי לנזקים (כולל הוצאות ושכר טרחת עורכי דין) אם אתה מציג באופן שגוי כי מוצר או פעילות מפר את זכויות היוצרים שלך. לפיכך, אם אינך בטוח שתוכן הממוקם באתר או מקושר אליו מפר את זכויות היוצרים שלך, עליך לשקול תחילה לפנות לעו"ד.

אנא בצע את השלבים הבאים כדי להגיש הודעה:

עליך לכלול את הדברים הבאים:

חתימה פיזית או אלקטרונית של בעל זכויות היוצרים או של אדם המורשה לפעול מטעמם זיהוי של זכויות היוצרים שטענו כי הופרה תיאור של אופיו ומיקומו המדויק של התוכן שלטענתך מפר את זכויות היוצרים שלך, במידה מספקת. פרט כדי לאפשר ל- Varsity Tutors למצוא ולזהות באופן חיובי את אותו תוכן למשל אנו דורשים קישור לשאלה הספציפית (לא רק שם השאלה) המכיל את התוכן ותיאור של איזה חלק ספציפי של השאלה - תמונה, קישור, הטקסט וכו ' - התלונה שלך מתייחסת לשמך, כתובתך, מספר הטלפון וכתובת הדוא"ל שלך והצהרה על ידך: (א) שאתה מאמין בתום לב שהשימוש בתוכן שלטענתך מפר את זכויות היוצרים שלך הוא לא מורשה על פי חוק, או על ידי בעל זכויות היוצרים או סוכן הבעלים כזה (ב) שכל המידע הכלול בהודעת ההפרה שלך מדויק, ו (ג) בעונש של עדות שקר, כי אתה או בעל זכויות היוצרים או אדם המורשה לפעול בשמם.

שלח את תלונתך לסוכן הייעודי שלנו בכתובת:

צ'ארלס קון וורסיטי חונכים LLC
101 S. Hanley Rd, סוויטה 300
סנט לואיס, MO 63105


אנו מודים לקרלה נויגבואר, אדוארד ברטרנד, דיוויד דרכסל, אנגוס למונד, ירון שב-טל, פאבל דראבר ומריה קארמו-פונסקה על שסיפקו לנו ריאגנטים ולגבי היינה על סיוע טכני מעולה. אנו אסירי תודה לחברי מעבדת סטאנק על קריאה ביקורתית.

תרומת מחבר: א.ר. עיצב וביצע את רוב הניסויים (איורים 1-6) והשתתף בכתיבת כתב היד C.W. isolated 12S, 15S ו-17S U2 snRNPs, C.G. חלקיקי snRNP מוכנים ומוזרקים במיקרו, טרום בוגרים ובוגרים (איורים 5 ו-7) K.K. הכין U4snRNA-MS2 מינימלי וביצע משקעים אימונו עם מבני U4-MS2, U2-MS2 ומוטציות Sm והשתתף בכתיבת כתב היד J.P ביצע את חיזוי מבנה ה-snRNA ו-D.S., R.L. ו-C.G. עיצב והעריך ניסויים וכתב את כתב היד.


RNAs גרעיניים קטנים שסונתזו לאחרונה מופיעים זמנית בציטופלזמה ☆

מיני RNA גרעיני קטן (snRNA) שסונתזו לאחרונה, Ul ו-U2 מזוהים בקלות בשברים ציטופלזמיים שהוכנו על ידי חלוקה סטנדרטית של תאים מימיים. עם זאת, מכיוון שמיני ה-snRNA היציבים הבוגרים דולפים מגרעינים מבודדים במהלך חלוקה של תאים, קיימת האפשרות שמינים אלה שסונתזו לאחרונה דולפים גם מהגרעין. כדי להתגבר על הבעיות של דליפה גרעינית, תאי L929 של עכבר חולקו על ידי שחרור תאים. Enucleation מוציא את הגרעינים מתאי טיפול בציטוצ'לסין ומייצר ציטופלסטים שעל פי מספר קריטריונים הם בְּתוֹם לֵב חלק ציטופלזמי לא מזוהם על ידי חומר גרעיני. כל ששת ה-snRNAs העיקריים נמצאים בציטופלסטים (c-snRNAs) זמן קצר לאחר הסינתזה. המינים מזוהים על ידי משקעים אימונו עם אנטיסרים ספציפיים כנגד הריבונוקלאופרוטאין ועל ידי Northern blotting ובחירה היברידית באמצעות בדיקות משובלות. זה מאשר ומרחיב מחקרים דומים שהשתמשו בפיצול תאים לא מימיים ובנתיחה ידנית כדי להתגבר על דליפה גרעינית. מחקרים קינטיים מראים שה-c-snRNAs חוזרים לגרעין הבין-פאזי לאחר כ-20 דקות בציטופלזמה. מבשר U2 U2′ מעובד ל-U2 בגודל בוגר בשברי הציטופלס לפני החזרה לגרעין. ה-c-snRNAs מתרחשים בחלקיקי ריבונוקלאופרוטאין בעלי אנטיגניות דומה לחלקיקים הגרעיניים הבוגרים תוך שש דקות מהשעתוק. זה מצביע על כך שבתאי יונקים, שלבים חשובים בהרכבת הריבונוקלאופרוטאין הללו מתרחשים בציטופלזמה.


דינמיקה תאית של RNAs קטנים

סקירה זו מדגישה את היציאה הגרעינית והיבוא הגרעיני המסובכים באופן בלתי צפוי של RNAs קטנים. למרות שסחר בגרעין/ציטופלזמה היה מוגבל ל-snRNA של רבים, אך לא כולם, איקריוטים, נתונים עדכניים מצביעים על כך שתנועה כזו עשויה להיות נפוצה יותר ממה שהוערך בעבר. ראשית, בניגוד לדיווחים קודמים רבים, מידע חדש מצביע על כך ש-Saccharomyces cerevisiae snRNAs עשויים לעבור מחזוריות בין הגרעין לציטופלזמה. שנית, מחקרים עדכניים מספקים גם ראיות לכך שרנ"א קטנים אחרים שמתפקדים באופן בלעדי בגרעין - ה-RNA הניצני של טלומראז השמרים ואולי RNAs גרעיניים קטנים - עשויים לצאת לציטופלזמה, רק כדי לחזור לגרעין. שלישית, מחזוריות של גרעין/ציטופלזמה של RNAs מתרחשת גם עבור RNAs שמתפקדים אך ורק בציטופלזמה, שכן התגלה ש-tRNA ציטופלזמה של שמרים ניצנים עוברים "במחור" לגרעין ואולי, בחזרה לציטופלזמה כדי לתפקד בחלבון סִינתֶזָה. רביעית, יש לפחות דוגמה אחת בריסיות של RNA דו-גדילי קטן העובר מחזורים מרובים בין הציטופלזמה וגרעינים שונים כדי לכוון את מבנה הגנום. דוח זה דן בנתונים התומכים או טוענים נגד תנועה דו-כיוונית של גרעין/ציטופלזמה עבור כל קטגוריה של RNA קטן ובתפקידים האפשריים שתנועה כזו עשויה לשרת.


חומרים ושיטות

תרבית תאים tsBN2, הכלאה של פלואורסצנטי באתר ואימונופלואורסצנטי

שורת התאים המוטנטית RCC1 הרגישה לטמפרטורה, tsBN2 (Ohtsubo et al., 1987), תופחה במדיום נשר שונה של Dulbecco (Sigma) בתוספת של 10% סרום בקר עוברי ב-33°C. הלוקליזציה של U3 snoRNA הן בטמפרטורה המתירנית (33 מעלות צלזיוס) והן בטמפרטורה הלא מתירנית (40 מעלות צלזיוס) נקבעה על ידי הכלאה של פלואורסצנטי באתרו (FISH) כפי שתואר במקום אחר (http://singerlab.aecom.yu.edu/ פרוטוקולים). בקצרה, התאים נזרעו על גבי כיסויי כיסוי בכ-80% התכנסות ואפשרו להיצמד למשך הלילה ולאחר מכן מחצית מגליונות הכיסוי הללו הועברו ל-40 מעלות צלזיוס. תאים נקבעו ב-4% פורמלדהיד (מדע מיקרוסקופי אלקטרונים), 10% חומצה אצטית (Sigma), 1×PBS ב-2 ו-6 שעות לאחר שינוי הטמפרטורה. תאים שנשמרו במקביל ב-33 מעלות צלזיוס נקבעו גם הם באותן נקודות זמן. לאחר חלחול עם 70% אתנול למשך הלילה ב-4 מעלות צלזיוס, התאים עברו הלימה מחדש עם 2×SSC, 50% פורמאמיד ונבדקו עם 30 ננוגרם של בדיקה של Cy3-מצומד U3 ספציפי antisense deoxyoligonucleotide במשך 3 שעות ב-37 מעלות צלזיוס במאגר הכלאה ( 10% דקסטרן סולפט, 2 מ"מ קומפלקס ונדיל-ריבונוקלאוזיד, 0.02% BSA ללא RNAse, 40 מיקרוגרם אי - קולי tRNA, 2×SSC ו-50% פורמאמיד). הבדיקה האנושית U3 (שמתקבלת מ-Operon Technologies) שבה נעשה שימוש היא 5'GQTCTCTCCCTCQCACTCCCCAAQACGGAGAGAAGAACGAQCATCAATGGCQG 3' כאשר Q מציין שאריות T שעברו שינוי באמינוליל המשולבים עבור צימוד Cy3. Cy3 התקבל מ-Amersham Pharmacia Biotech והצימוד בוצע בהתאם להמלצות היצרן. האוליגו המשתנה טוהר מצבע Cy3 לא תגובתי באמצעות ערכה להסרת נוקלאוטידים (Qiagen). בדיקות מצמודות הופעלו על 8% ג'לים של פוליאקרילאמיד לא מטבעים וזוהו באמצעות תאורת UV כדי להעריך את היעילות של צימוד והתאוששות לאחר טיהור. אימונופלואורסצנטי עקיף בוצע כמתואר במקום אחר (http://singerlab.aecom.yu.edu/protocols) תוך שימוש בדילול 1:100 של נוגדנים נגד טרימתיל גואנוזין (TMG) (Bringmann et al., 1983) ו-1: דילול 50 של נוגדנים משניים נגד ארנבת מצומדים Cy2 (מעבדות ג'קסון אימונוריסק). כיסויי כיסוי הותקנו על שקופיות עם 90% גליצרול ב-1×PBS המכילים 1 מ"ג/מ"ל ע'-פנילן דיאמין ו-1 מיקרוגרם/מ"ל 4,6-דיאמינו-2-פנילינדול (DAPI).

זני שמרים ומדיה

כל זני השמרים גודלו במדיום תמצית שמרים פפטון דקסטרוז (YEPD) בתנאים סטנדרטיים (Adams et al., 1997). הגנוטיפ הרלוונטי לזן הבר, ACY192, הוא מַחצֶלֶתא ura3-52, trp1- Δ63,leu21. נעשה שימוש גם במוטנטים הרגישים לטמפרטורה הבאים: ACY212, מַחצֶלֶתא GSP1::HIS3 GSP2::HIS3 ura3-52 leu21, trp163 (שונה עם א gsp1-1, LEU, AMP, CEN פלסמיד (pAC413) או עם א gsp1-2, LEU,AMP, CEN פלסמיד (pAC414)) (Wong et al., 1997) ACY109 מַחצֶלֶתא prp20-1 trp1 leu21 ura3 (Amberg et al., 1993) ו-ACY61, מַחצֶלֶתא rna1-1 leu21 ura3-52 his3(Corbett et al., 1995a).

הקרנת שמרים במקום הכלאה ואימונופלואורסצנטיות

ניתוח FISH ואימונופלואורסצנציה בשמרים בוצעו כמתואר (Amberg et al., 1992 Wong et al., 1997) פרט לכך שנעשה שימוש בבדיקות DNA עם תווי Cy3. הבדיקות האנטי-חושיות של דאוקסי-אוליגונוקלאוטידים נגד שמרים U3 snoRNA (5'ATTCAGTGGCTCTTTTGAAGAGTCAAAGAGTGACGATTCCTATAGAAATGA 3'), snR10 snoRNA(5' CAGACGACAGAAAGACTGTTGCACCCAAGATCGATAAATTTGTTCTCCAGTAT)s עם synds op-d-a-poly(5′ טכנולוגיות) ו-single Op תווית Cy3 בקצה 5'. בקצרה, הזנים גודלו ב-YEPD בטמפרטורת החדר והועברו ל-37 מעלות צלזיוס למשך 3 שעות. תאים מקובעים בפורמלדהיד נקצרו, עברו פלסטיק עם 300 מיקרוגרם של Zymolyase 100T (US Biological), הוספו מחדש בתמיסת P (1.2 M sorbitol ב-0.1 M אשלגן פוספט חיץ, pH 6.5) והונחו על שקופיות 14-טפלון עם פנים מיקרוסקופ-פוינט. Scientific, Inc.) מצופה מראש ב-0.1% פוליזין. לאחר חדירות עם 0.5% IGEPAL, הכלאה בוצעה באמצעות 100-150 ng של בדיקה מסומנת Cy3 למשך הלילה ב-37 מעלות צלזיוס. בניסויים מסוימים, בוצעה גם פלואורסצנטי חיסוני עקיף כפי שתואר קודם (Wong et al., 1997) תוך שימוש בדילול 1:1000 של נוגדנים חד שבטיים אנטי-Nop1p (A66) (Aris and Blobel, 1988) ודילול 1:50 של טקסס -נוגדנים משניים נגד עכבר מצומדים באדום (Jackson Immunoresearch Laboratories). תאים נצבעו ב-1 מיקרוגרם/מ"ל 4,6-דיאמינו-2-פנילינדול (DAPI), יבשו באוויר והותקנו ב-1 מ"ג. ע'-פנילן דיאמין/מ"ל 90% גליצרול ב-1×PBS.

Xenopus laevis הזרקת מיקרו ביציות וניתוח RNA

השמירה הגרעינית והלוקליזציה הגרעינית של U3 snoRNA או U65 snoRNA מסומנת מיקרו-זריקת פלואורסצנטית נבדקה כמתואר קודם לכן (Narayanan et al.,1999a Narayanan et al.,1999b Speckmann et al.,1999) ב- קסנופוס ביציות בהן מערכת Ran השתבשה באמצעות Ran T24N. ה-RNAs להזרקת מיקרו הועתקו במבחנה עם תווית fluorescein-12-UTP (לזיהוי באמצעות מיקרוסקופיה פלואורסצנטית) ותווית 32 P-GTP (לזיהוי באמצעות אלקטרופורזה ג'ל ואוטורדיוגרפיה). מוטאנט T24N רקומביננטי Ran הובע וטיהרו ממנו אי - קולי כפי שתואר קודם (Lounsbury et al., 1996). 32 P מסומן, U1sm - snRNA (ו-U3 snoRNA באיור. 5C ו-D) הוזרקו יחד עם RNAs המסומנים עם פלואורססאין כבקרות לייצוא גרעיני (או שימור) של RNA. 40 מיקרומול של Ran T24N ב-10 נ"ל של חיץ מיקרו הזרקה (10 מ"מ NaH2פו4, pH 7.2, 70 מ"מ KCl, 1 מ"מ MgCl2 ו-10 מ"ג/מ"ל כחול דקסטרן) או 10 נ"ל של חיץ מיקרו-הזרקה בלבד הוזרק לתוך הגרעינים של ביציות בשלב V/VI. הביציות הודגרו ב-18 מעלות צלזיוס למשך שעה אחת לפני הזרקה גרעינית שנייה המכילה 1 fmole של fluorescein/32 P-GTP המסומן U3 או U65. לצורך ניתוח לוקליזציה תוך-גרעינית, הביציות הודגרו ב-18 מעלות צלזיוס, והגרעינים נותחו ארבע שעות לאחר הזרקת ה-RNA. התוכן של כל גרעין מנותח הועבר לשקופית של מיקרוסקופ. השקופיות עברו צנטריפוגה, קבועה, הותקנו והועברו למיקרוסקופ פלואורסצנטי כמתואר (Narayanan et al.,1999a Narayanan et al.,1999b). לצורך ניתוח התפלגות נוקלוציטופלזמה, RNA הופק מהחלקים הגרעיניים והציטופלזמיים מחלקים אחרים של קבוצת הביציות המוזרקות, וה-RNA המסומנים רדיואקטיביים זוהו על ידי 8% דנטורציה של ג'ל אלקטרופורזה ואוטורדיוגרפיה.

SnoRNAs U3 ו-U65 שהוזרקו במיקרו נשמרים בתוך הגרעין וממוקמים לגרעין של קסנופוס ביציות לאחר הזרקת T24N Ran.(A,C) RanT24N רקומביננטי במאגר מיקרו-הזרקה (לוחות תחתונים) או חיץ מיקרו-הזרקה בלבד (פאנלים עליונים) הוזרקו לקבוצות נפרדות של ביציות. שעה לאחר מכן, הוזרק לאותה קבוצה של ביציות ב-Fmole אחת של U3 או U65 snoRNA בעל תווית פלואורסצנטית ו-32 P. ממרחים גרעיניים בוצעו ארבע שעות לאחר הזרקת ה-RNA, ושקופיות נותחו במיקרוסקופ פלואורסצנטי. מספר נוקלאולים בודדים מוצגים בכל לוח ניגודיות הפרעות דיפרנציאליות (DIC). אותות הקרינה (RNA) מראים שה- snoRNAs המוזרק מכוונים לתת-אזור הממוקם במרכז של הנוקלאוליים בביציות, אשר הוזרקו עם T24N Ran (+T24N).(B,D) Nuclear (N) וציטופלזמי (C) שברים התקבלו מאותה קבוצה של תאים שהוזרקו. RNA הופץ משברי N ו-C והועבר ל-PAGE דנטורציה ואחריו אוטורדיוגרפיה. מסלול הסימון (M) מציין דגימות לפני ההזרקה.

SnoRNAs U3 ו-U65 שהוזרקו במיקרו נשמרים בתוך הגרעין וממוקמים לגרעין של קסנופוס ביציות לאחר הזרקת T24N Ran.(A,C) RanT24N רקומביננטי במאגר מיקרו-הזרקה (לוחות תחתונים) או חיץ מיקרו-הזרקה בלבד (פאנלים עליונים) הוזרקו לקבוצות נפרדות של ביציות. שעה לאחר מכן, הוזרק לאותה קבוצה של ביציות ב-fmole אחת של U3 או U65 snoRNA בעל תווית פלואורסצנטית ו-32 P. ממרחים גרעיניים בוצעו ארבע שעות לאחר הזרקת ה-RNA, ושקופיות נותחו במיקרוסקופ פלואורסצנטי. מספר נוקלאולים בודדים מוצגים בכל לוח ניגודיות הפרעות דיפרנציאליות (DIC). אותות הקרינה (RNA) מראים שה- snoRNAs המוזרקים מכוונים לתת-אזור הממוקם במרכז של הנוקלאוליים בביציות, אשר הוזרק עם ה-T24N Ran (+T24N).(B,D) Nuclear (N) וציטופלזמי (C) שברים התקבלו מאותה קבוצה של תאים שהוזרקו. RNA הופץ משברי N ו-C והועבר ל-PAGE דנטורציה ואחריו אוטורדיוגרפיה. מסלול הסימון (M) מציין דגימות לפני ההזרקה.

מיקרוסקופיה

מיקרוסקופיה בוצעה באמצעות מיקרוסקופ פלואורסצנטי הפוך של Zeiss Axiovert S 100 המצויד באופטיקה של ניגודיות הפרעות דיפרנציאלית (Thornwood, NY, ארה"ב). התמונות נרכשו באמצעות מצלמת התקן מקוררת (Quantix-Photometrix, AZ, ארה"ב) ותוכנת IP Lab Spectrum (Signal Analytics, VA).