מֵידָע

הגברה של PCR והפצת שגיאות

הגברה של PCR והפצת שגיאות


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

נגיד שיש לי dsDNA אחד שעובר PCR תקין (כאשר ההגברה היא אקספוננציאלית). אם יש טעות, נניח ש-G מוחלף ל-A במהלך הסבב השני של השכפול, באיזה אחוז מה-DNA הסופי תהיה הטעות אם יהיו 12 סבבים נוספים?

דיברתי עם המורה שלי על זה היום. אני אומר 33%, המורה שלי אמר 12.5%.


אני אפרמט אותו ל-.ppt ברגע שיהיה לי יותר זמן! אם משהו אינו קריא, אנא הודע לי!

אני חייב לציין כמה דברים:

  1. חלקן של מולקולות DNA שגויות אינו תלוי במספר המחזורים (כל עוד מספר המחזורים גבוה מ-2).

  2. יש יוצא מן הכלל אחד: אם המוטציה מתרחשת מחוץ לאזור שיש להגביר (לדוגמה במולקולה הרביעית, במורד אזור העניין), המספר הכולל של מולקולות DNA שגויות יהיה 0.


המורה שלך אכן צודק.

בסיבוב הראשון תקבלו שתי מולקולות זהות של ה-dsDNA.

בסיבוב השני תקבלו 3 מולקולות זהות ומולקולרית אחת עם anאהחליף אGבאחד הגדילים. כְּלוֹמַר.

אין שגיאה (3 מתוך 4 מולקולות):

------G------- ------C-------

אי התאמה אחת (1 מתוך 4 מולקולות):

------א------- ------C-------

אז יש בסך הכל 8 גדילים של DNA אחרי הסיבוב השני ולאחד מהגדילים האלה יש חוסר התאמה.1 / 8= 0.125 = 12.5%

בסיבוב 3 יהיו לך 8 מולקולות dsDNA ורק לאחת מ-8 מולקולות dsDNA האלה תהיה חוסר התאמה.


מהי תגובת שרשרת פולימראז (PCR)?

PCR מייצג תגובת שרשרת פולימראז, טכניקת ביולוגיה מולקולרית להגברת מקטעים של DNA, על ידי יצירת עותקים מרובים באמצעות אנזימי DNA פולימראז בתנאים מבוקרים. ניתן לשבט מעט עותק בודד של קטע DNA או גן למיליוני עותקים, מה שמאפשר זיהוי באמצעות צבעים וטכניקות הדמיה אחרות.

תהליך ה-PCR, שפותח בשנת 1983, איפשר לבצע רצף DNA ולזהות את סדר הנוקלאוטידים בגנים בודדים. השיטה משתמשת במחזוריות תרמית או בחימום וקירור חוזרים ונשנים של התגובה להמסה ושכפול של DNA. ככל שה-PCR נמשך, ה-DNA ה"חדש" משמש כתבנית לשכפול ומתחוללת תגובת שרשרת, המגבירה באופן אקספוננציאלי את תבנית ה-DNA.

טכניקות PCR מיושמות בתחומים רבים של ביוטכנולוגיה לרבות הנדסת חלבונים, שיבוט, זיהוי פלילי (טביעת אצבע של DNA), בדיקות אבהות, אבחון מחלות תורשתיות ו/או זיהומיות ולניתוח דגימות סביבתיות.

בזיהוי פלילי, במיוחד, PCR שימושי במיוחד מכיוון שהוא מגביר אפילו את הכמות הקטנה ביותר של ראיות DNA. ניתן להשתמש ב-PCR גם לניתוח DNA בן אלפי שנים, וטכניקות אלו שימשו לזיהוי כל דבר, החל מממותה בת 800,000 שנה ועד מומיות מרחבי העולם.


שיטת שיבוט PCR

שיבוט PCR שונה משיבוט מסורתי בכך שניתן להגביר את קטע ה-DNA המעניין, ואפילו את הווקטור, על ידי תגובת שרשרת ה- Polymerase Chain Reaction (PCR) ולקשר יחדיו, ללא שימוש באנזימי הגבלה. שיבוט PCR הוא שיטה מהירה לשיבוט גנים, והיא משמשת לעתים קרובות לפרויקטים הדורשים תפוקה גבוהה יותר ממה ששיטות שיבוט מסורתיות יכולות להכיל. היא מאפשרת שיבוט של שברי DNA שאינם זמינים בכמויות גדולות.

בדרך כלל, תגובת PCR מבוצעת כדי להגביר את רצף העניין, ולאחר מכן היא מחוברת לוקטור באמצעות קשירה קהה או בסיס יחיד לפני השינוי. שיבוט PCR מוקדם נעשה שימוש לעתים קרובות טאק DNA פולימראז להגברת הגן. כתוצאה מכך נוצר תוצר PCR עם תוספת בסיס בודדת בלתי תלויה בתבנית של שארית אדנין (A) לקצה ה-3' של תוצר ה-PCR, באמצעות הפעולה הרגילה של הפולימראז. מוצרים "A-tailed" אלה נקשרים לאחר מכן לוקטור T-tailed משלים באמצעות T4 DNA ligase, ולאחר מכן טרנספורמציה.

פולימראזות DNA בנאמנות גבוהה משמשים כעת באופן שגרתי להגברת רצפים עם מוצר PCR שאינו מכיל הרחבות 3'. קטעי הקצה הקהה מחוברים לוקטור פלסמיד באמצעות תגובת קשירה אופיינית או על ידי פעולת וקטור "מופעל" המכיל אנזים מחובר קוולנטי, בדרך כלל Topoisomerse I, המקל על החיבור של vector:insert. חלק ממערכות שיבוט PCR מכילות וקטורים מהונדסים של "התאבדות" הכוללים גן רעיל שאליו יש לקשור בהצלחה את תוצר ה-PCR כדי לאפשר התפשטות של הזן שקולט את המולקולה הרקומביננטית במהלך הטרנספורמציה.

חסרון טיפוסי המשותף לשיטות שיבוט PCR רבות הוא וקטור ייעודי שיש להשתמש בו. וקטורים אלה נמכרים בדרך כלל על ידי ספקים, כמו NEB, בפורמט ליניארי מוכן לשימוש ויכולים להוסיף הוצאה משמעותית לעלות הכוללת של שיבוט. כמו כן, השימוש בוקטורים ספציפיים מגביל את בחירתו של החוקר בעמידות לאנטיביוטיקה, זהות מקדם, שותפי היתוך ואלמנטים רגולטוריים אחרים.

  • יעילות גבוהה, עם וקטורים ייעודיים
  • נגיש לתפוקה גבוהה
  • אפשרויות וקטור מוגבלות
  • עלות גבוהה יותר
  • חוסר בקרת רצף בצומת
  • שיבוט מרובה מקטעים אינו ישר קדימה
  • שיבוט כיווני קשה

שיבוט PCR

שימו לב שהזמנים מבוססים על הערכות להעברת גן מפלסמיד אחד למשנהו. אם המקור להעברת גנים הוא gDNA, הוסף 2 שעות לחישוב עבור שיטת השיבוט המסורתית. הזמן הכולל אינו כולל טרנספורמציה, בידוד או ניתוח.

ניתוח תוצר ה-PCR

ישנן שתי שיטות עיקריות להמחיש את תוצרי ה-PCR: (1) צביעה של תוצר ה-DNA המוגבר בצבע כימי כגון אתידיום ברומיד, המתערב בין שני הגדילים של הדופלקס או (2) סימון פריימרים או נוקלאוטידים של PCR בפלורסנט. צבעים (פלואורופורים) לפני הגברה של PCR. השיטה האחרונה מאפשרת לשלב את התוויות ישירות במוצר ה-PCR. השיטה הנפוצה ביותר לניתוח מוצר ה-PCR היא השימוש באלקטרופורזה של ג'ל אגרוז, המפרידה בין מוצרי DNA על בסיס גודל ומטען. אלקטרופורזה של ג'ל אגרוז היא השיטה הקלה ביותר להמחשה וניתוח של מוצר ה-PCR. היא מאפשרת קביעת נוכחות וגודל תוצר ה-PCR (איור 2). קבוצה קבועה מראש של מוצרי DNA עם גדלים ידועים מופעלת בו זמנית על הג'ל כסמנים מולקולריים סטנדרטיים כדי לסייע בקביעת גודל המוצר.

מתוך Riedl et al, 2004: זיהוי של תמליל Langerin של עכבר שחובר לחלופין. (א) ג'ל אגרוז מוכתם באתידיום ברומיד המראה מוצרי PCR מלנגרין עכבר באורך מלא המתקבל מ-C57BL/6 טרי LC (fLC) ומתאי דנדריטים שמקורם בעור העובר (FSDDC).

בדרך כלל, כאשר משתמשים ב-PCR כדי לזהות נוכחות או היעדר של מוצר DNA ספציפי, זה נקרא אֵיכוּתִי PCR. PCR איכותי היא טכניקה טובה לשימוש כאשר PCR מבוצע למטרות שיבוט או לזיהוי פתוגן. לדוגמה, בדו"ח של Dworkin וחב', נעשה שימוש ב-PCR איכותי כדי לזהות נוכחות של וירוס פוליומה של תאי מרקל בקרצינומה של תאי קשקש עוריים (SCC) אצל אנשים בעלי יכולת חיסונית (2009). באמצעות DNA גנומי שבודד מ-SCCs שנכרתו מיחידים בעלי יכולת חיסונית ופריימרים ספציפיים לגנים של וירוסים, החוקרים הצליחו להדגים נוכחות של גן ויראלי של 351 זוג בסיסים (bp) ב-6 מתוך 16 דגימות שנבדקו, על ידי נוכחות של מוצר PCR. פס באורך של כ-351 bp, כפי שניתן לראות על ג'ל אגרוז 2% עם אתידיום ברומיד (איור 3). הניסוי כלל גם תבנית DNA מווירוס פוליאומה המכיל פלסמיד כבקרת חיובית (P) ובקרת מים שלילית (W). הנתיב הראשון המסומן על ידי (M) הוא הסמן המולקולרי, המשמש לזיהוי גודל תוצר ה-PCR שזוהה. הנוכחות של גן ויראלי ספציפי שזוהה על ידי PCR מסומנת על ידי (+) היעדר גן ויראלי מסומן על ידי (−).

מתוך Drowkin et al, 2009: זיהוי MCPyV. (א) נוכחות MCPyV ב-SCCs, DNA נורמלי גנומי ו-DNA עור סמוך נקבעה על ידי PCR באמצעות פריימרים VP1. תוצאה ייצוגית מוצגת עם 6 מתוך 16 דגימות שנבדקו המראות תוצר PCR ב-351 bp. כל הניסויים כללו DNA מפלסמיד MCPyV כבקרה חיובית (P) ובקרת מים שלילית (W). M, סמן משקל מולקולרי +, חיובי עבור וירוס −, שלילי עבור וירוס.


מדריך לפתרון בעיות PCR

בעיות נפוצות ב-PCR קשורות בעיקר לתנאי תגובה, דיוק רצף, ותפוקת הגברה וסגוליות. בדף זה, למד על הסיבות האפשריות שלהם ועל ההמלצות שלנו כיצד לפתור בעיות אלה.

בעמוד זה:

  • צמצם למינימום גזירה וחיתוך של DNA במהלך הבידוד. הערכת שלמות ה-DNA של התבנית על ידי אלקטרופורזה ג'ל, במידת הצורך.
  • אחסן DNA במים בדרגה מולקולרית או במאגר TE (pH 8.0) כדי למנוע פירוק על ידי נוקלאזות.
  • בצע את המלצות היצרן בקפדנות בעת שימוש בערכות טיהור לבידוד DNA של תבנית. עיין במדריך למשתמש ובמדריכים לפתרון בעיות כדי להפחית איכות DNA ירודה.
  • ודא שלא קיימים מעכבי PCR שיוריים כגון פנול, EDTA ופרוטאינז K אם עוקבים אחר פרוטוקולי טיהור DNA כימיים או אנזימטיים.
  • לטהר מחדש, או לזרז ולשטוף DNA עם 70% אתנול, כדי להסיר שאריות מלחים או יונים (למשל, K + , Na + וכו ') שעלולים לעכב פולימראזות DNA.
  • בחרו בפולימראזות DNA עם תהליכים גבוהים, המציגים סבילות גבוהה למעכבי PCR נפוצים הנישאים מאדמה, דם, רקמות צמחיות וכו'.
  • בדוק את כמות ה-DNA הקלט והגדל את הכמות במידת הצורך.
  • בחר DNA פולימראזות עם רגישות גבוהה להגברה.
  • אם מתאים, הגדל את מספר מחזורי ה-PCR.
  • בחרו בפולימראזות של DNA עם עיבוד גבוה, המציגים זיקה גבוהה לתבניות DNA ומתאימים יותר להגברת מטרות קשות.
  • השתמש בתוסף PCR או ממס משותף כדי לסייע בדנאטורציה של DNA עשיר ב-GC ורצפים עם מבנים משניים.
  • הגדל את זמן הדנטורציה ו/או הטמפרטורה כדי להפריד ביעילות תבניות DNA דו-גדיליות.
  • בדוק את יכולת אורך ההגברה של פולימראזות ה-DNA שנבחרו. השתמש בפולימראזות DNA שתוכננו במיוחד עבור PCR ארוך.
  • בחר פולימראזות DNA עם תהליכים גבוהים, שיכולים להגביר מטרות ארוכות בזמן קצר יותר.
  • הפחת את טמפרטורות החישול והארכה כדי לעזור לקשירת פריימר וליציבות תרמוסית של האנזים.
  • הארך את זמן הארכה לפי אורכי האמפליקון.
  • סקירת עיצוב פריימר. השתמש בכלי עיצוב פריימר מקוונים כאשר מתאים.
  • ודא שהפריימרים הם ספציפיים ליעד העניין.
  • ודא שהפריימרים משלימים לגדילים הנכונים של ה-DNA היעד.
  • כמות פריימרים לאחר ההשעיה מחדש ואחסנה כראוי.
  • צור מחדש מנות פריימר טריות, או השג פריימרים חדשים במידת הצורך.
  • ייעול ריכוזי פריימר (בדרך כלל בטווח של 0.1-1 מיקרומטר).
  • עבור PCR ארוך ו-PCR עם פריימרים מנוונים, התחל עם ריכוז מינימלי של 0.5 מיקרומטר.
  • השתמש בפולימראזות DNA עם התחלה חמה כדי למנוע פירוק של פריימרים על ידי פעילות האקסונוקלאז 3'→5' של הגהה של פולימראזות DNA. פולימראזות DNA עם התחלה חמה גם מגדילות את התשואות של מוצרי ה-PCR הרצויים על ידי ביטול הגברה לא ספציפית.
  • לחלופין, הגדר PCR על קרח, או הוסף DNA פולימראז אחרון לתערובת התגובה.
  • בחר DNA פולימראזות עם רגישות גבוהה להגברה.
  • סקור המלצות לגבי כמות ה-DNA פולימראז לשימוש ב-PCR, ובצע אופטימיזציה לפי הצורך.
  • הגדל את כמות ה-DNA פולימראז אם תערובת התגובה מכילה ריכוז גבוה של תוסף (למשל, DMSO, פורמאמיד) או מעכבים ממקורות הדגימה.
  • ייעול ריכוז Mg 2+ לתשואות PCR מקסימליות. הנוכחות של EDTA, chelators מתכות אחרים, או ריכוזים גבוהים באופן לא טיפוסי של dNTPs עשוי לדרוש ריכוז Mg 2+ גבוה יותר.
  • בדוק את העדפת ה-DNA פולימראז לתמיסות מלח מגנזיום. לדוגמה, Pfu DNA פולימראז עובד טוב יותר עם MgSO4 מאשר עם MgCl2.
  • סקור את הריכוזים המומלצים של תוספי PCR או ממיסים משותפים. השתמש בריכוז הנמוך ביותר האפשרי כאשר מתאים.
  • התאם את טמפרטורות החישול, מכיוון שריכוזים גבוהים של תוספי PCR או ממיסים משותפים מחלישים את הקישור של פריימר למטרה.
  • הגדל את כמות ה-DNA פולימראז, או השתמש בפולימראזות DNA עם תהליכי עיבוד גבוהים.
  • שקול להשתמש בתוסף או ממס משותף שנוסח במיוחד עבור פולימראז DNA נתון (למשל, GC Enhancer המסופק עם פולימראזות DNA של Invitrogen Platinum).
  • ודא שפולימראזות ה-DNA שנבחרו מסוגלים לשלב את הנוקלאוטידים המותאמים.
  • ייעל את היחס בין הנוקלאוטיד המשונה ל-dNTP כדי להגביר את יעילות ה-PCR.
  • ערבבו את מניות הריאגנטים והתגובות המוכנות ביסודיות כדי למנוע שיפוע צפיפות שייתכן שנוצרו במהלך האחסון וההגדרה.
  • מטב את זמן הדנטורציה והטמפרטורה של ה-DNA. זמני דנטורציה קצרים וטמפרטורות נמוכות עשויים שלא להפריד היטב בין תבניות DNA דו-גדיליות. מצד שני, זמני דנטורציה ארוכים וטמפרטורות גבוהות עשויים להפחית את פעילות האנזים.
  • בצע אופטימיזציה של טמפרטורת החישול בהדרגה במרווחים של 1-2 מעלות צלזיוס, באמצעות מחזור שיפוע כאשר זמין. טמפרטורת החישול האופטימלית היא בדרך כלל 3-5 מעלות צלזיוס מתחת לפריימר T הנמוך ביותרM.
  • התאם את טמפרטורת החישול כאשר נעשה שימוש בתוסף PCR או ממס משותף.
  • השתמש בטמפרטורת החישול המומלצת עבור פולימראז DNA ספציפי במאגר האופטימלי שלו. כללי טמפרטורת חישול עבור ערכות פריימר יכולים להשתנות בין פולימראזות DNA שונות.
  • בחר זמן הארכה המתאים לאורך האמפליקון.
  • הפחת את טמפרטורת הארכה (למשל, ל-68 מעלות צלזיוס) כדי לשמור על האנזים פעיל במהלך הגברה של מטרות ארוכות (למשל, >10 kb).
  • השתמש בפולימראזות DNA עם עיבוד גבוה להגברה חזקה אפילו עם זמני הארכה קצרים.
  • התאם את מספר המחזורים (בדרך כלל ל-25-35 מחזורים) כדי לייצר תשואה נאותה של מוצרי PCR. הארך את מספר המחזורים ל-40 אם קלט ה-DNA הוא פחות מ-10 עותקים.
  • סקור את הכמויות האופטימליות של קלט DNA. הורד את הכמות כדי להפחית את יצירת מוצרי PCR לא ספציפיים.
  • DNA מושפל עשוי להופיע כמריחות או להוביל לרקע גבוה באלקטרופורזה של ג'ל. צמצם למינימום גזירה וחיתוך של DNA במהלך הבידוד.
  • הערך את שלמות ה-DNA של התבנית לפני PCR על ידי אלקטרופורזה ג'ל, במידת הצורך. אחסן DNA במים בדרגה מולקולרית או במאגר TE (pH 8.0) כדי למנוע פירוק על ידי נוקלאזות.
  • בחרו בפולימראזות של DNA עם עיבוד גבוה, המציגים זיקה גבוהה לתבניות DNA ומתאימים יותר להגברת מטרות קשות.
  • השתמש בתוסף PCR או ממס משותף כדי לסייע בדנאטורציה של DNA עשיר ב-GC ורצפים עם מבנים משניים. הגדל את זמן הדנטורציה ו/או הטמפרטורה כדי להפריד ביעילות תבניות DNA דו-גדיליות.
  • בדוק את יכולת אורך ההגברה של פולימראזות ה-DNA שנבחרו. השתמש בפולימראזות DNA שתוכננו במיוחד עבור PCR ארוך.
  • בחר פולימראזות DNA עם תהליכים גבוהים, שיכולים להגביר מטרות ארוכות בזמן קצר יותר.
  • הפחת את טמפרטורות החישול והארכה כדי לעזור לקשירת פריימר וליציבות תרמית של האנזים. הארך את זמן הארכה לפי אורכי האמפליקון.
  • סקירת עיצוב פריימר. השתמש בכלי עיצוב פריימר מקוונים כאשר מתאים. ודא שהפריימרים ספציפיים למטרה, עם הומולוגיה מינימלית לאזורים אחרים בתבנית.
  • ודא שהפריימרים אינם מכילים רצפים משלימים או נוקלאוטידים G או C עוקבים בקצוות 3′, כדי למנוע היווצרות פריימר-דימר.
  • הימנע מחזרות ישירות בפריימרים כדי למנוע חוסר יישור בקישור למטרה. שקול פריימרים ארוכים יותר כדי לשפר את הספציפיות.
  • שקול PCR מקונן כדי לשפר את הספציפיות.
  • ייעול ריכוזי פריימר (בדרך כלל בטווח של 0.1-1 מיקרומטר). ריכוזי פריימר גבוהים מעודדים יצירת פריימר-דימר.
  • סקור את ההמלצות לגבי כמות ה-DNA פולימראז לשימוש ב-PCR, והפחת לפי הצורך.
  • השתמש בפולימראזות DNA עם התחלה חמה שאין להם פעילות בטמפרטורת החדר אך מתפקדים רק לאחר שלב הפעלה בטמפרטורה גבוהה, כדי לשפר את הספציפיות. עם פולימראזות DNA ללא התחלה חמה, הגדר PCR על קרח כדי לשמור על פעילות אנזים נמוכה.
  • סקור את ריכוזי Mg 2+ והוריד לפי הצורך כדי למנוע מוצרי PCR לא ספציפיים. ייעול ריכוזי Mg 2+ עבור כל סט פריימר ו-DNA יעד.
  • הגדל את זמן הדנטורציה ו/או הטמפרטורה כדי להפריד ביעילות את ה-DNA בעת עבודה עם תבניות ורצפים עשירים ב-GC עם מבנים משניים.
  • השתמש בטמפרטורת החישול המומלצת עבור פולימראז DNA ספציפי במאגר האופטימלי שלו. כללי טמפרטורת חישול עבור ערכות פריימר יכולים להשתנות בין פולימראזות DNA שונות.
  • הגדל את טמפרטורת החישול כדי לשפר את הספציפיות. טמפרטורת החישול האופטימלית היא בדרך כלל לא פחות מ-3-5 מעלות צלזיוס מתחת לפריימר T הנמוך ביותרM.
  • בצע אופטימיזציה של טמפרטורת החישול בהדרגה במרווחים של 1-2 מעלות צלזיוס, באמצעות מחזור שיפוע כאשר זמין.
  • שקול טאצ'דאון PCR כדי לשפר את הספציפיות.
  • קצר את זמן החישול כדי למזער את קישור פריימר לרצפים לא ספציפיים.
  • הפחת את טמפרטורת ההארכה ל-3-4 מעלות צלזיוס כדי לעזור ליציבות התרמוסית של ה-DNA פולימראז, במיוחד עבור PCR ארוך.
  • הארך את זמן הארכה בעת הגברה של מטרות DNA ארוכות.
  • כלול שלב הארכה אחרון עם מספיק זמן (5-15 דקות) כדי להרחיב את כל היעד.
  • הפחיתו את מספר המחזורים, מבלי להוריד באופן דרסטי את התפוקה של מוצרי ה-PCR הרצויים, כדי למנוע הצטברות של אמפליקונים לא ספציפיים.
  • השתמש בפולימראזות DNA עם נאמנות גבוהה במיוחד כדי ליצור שברי PCR עבור יישומים במורד הזרם כגון שיבוט, רצף ומוטגנזה מכוונת אתרים.
  • סקור את ריכוזי Mg 2+ והפחית לפי הצורך. ריכוזים מוגזמים מעדיפים שילוב מוטעה של נוקלאוטידים על ידי פולימראזות DNA.
  • ודא ריכוזים שווה מולרים של dATP, dCTP, dGTP ו-dTTP בתגובה. ריכוזי נוקלאוטידים לא מאוזנים מעלים את שיעור שגיאות ה-PCR.
  • צמצם את מספר המחזורים מבלי להוריד באופן דרסטי את התשואה של מוצרי ה-PCR הרצויים. מספרים גבוהים של מחזורים מגבירים את השילוב של נוקלאוטידים לא תואמים.
  • הגדל את כמות ה-DNA הקלט כאשר מתאים כדי להימנע מהפעלת מספר מוגזם של מחזורים.
  • השתמש בקופסת אור UV באורך גל ארוך (360 ננומטר) כדי לדמיין שברים בג'לים, ולהגביל את זמן ההארה ככל האפשר.
  • אם אתה משתמש בקופסת אור באורך גל קצר (254-312 ננומטר), הגבל את תאורת ה-UV למספר שניות ושמור את הג'ל על צלחת זכוכית או פלסטיק.
  • לחלופין, השתמש בצבעים עם עירור באורך גל ארוך יותר (פחות מזיק) כדי לדמיין את ה-DNA.
  • רצף את שני גדילי ה-DNA כדי לאמת את מהימנות תוצאות הרצף. השתמש בדגימות כפולות כאשר מתאים.
  • הימנע מחזרות ישירות בתוך רצפי פריימר, מכיוון שעלולות להופיע חזרות מרובות כתוצאה מחוסר יישור רצף בקצות תוצרי ה-PCR.
  • הזמינו פריימרים של PCR עם טיהור כדי להסיר אוליגו של DNA שאינם באורך מלא, הקטועים בקצוות 5' שלהם.
  • השתמש בריאגנטים נטולי נוקלאז בדרגה מולקולרית בהגדרת PCR. הגדר תגובות על קרח כדי לשמור על פעילות נמוכה של אקסונוקלאזים מזהמים אפשריים.
  • השתמש בקופסת אור UV באורך גל ארוך (360 ננומטר) כדי לדמיין שברים בג'לים, ולהגביל את זמן ההארה ככל האפשר.
  • אם אתה משתמש בקופסת אור באורך גל קצר (254-312 ננומטר), הגבל את תאורת ה-UV למספר שניות ושמור את הג'ל על צלחת זכוכית או פלסטיק.
  • לחלופין, השתמש בצבעים עם עירור באורך גל ארוך יותר (פחות מזיק) כדי לדמיין את ה-DNA.
  • רצף את שני גדילי ה-DNA כדי לאמת את מהימנות תוצאות הרצף. השתמש בדגימות כפולות כאשר מתאים.
  • הימנע מפריימרים המכילים רצפים משלימים ומשלימים עצמיים, המעדיפים יצירת פריימר-דימר ואוליגומריזציה עצמית והגברה לאחר מכן.
  • הימנע מזיהום של DNA בסביבת העבודה על ידי ביצוע המלצות כלליות להגדרת PCR.
  • השתמש בקצות פיפטה עם מחסומי אירוסול. הקדישו אזור עבודה נפרד וטהר את האזור לאחר כל שימוש.
  • עקוב אחר טכניקות בקרת העברה של PCR כגון שילוב dUTP עם טיפול UDG.

לסיוע נוסף בפתרון בעיות, בקר במרכז התמיכה של PCR ו-PCR Primers End-Point או צור קשר עם צוות התמיכה הטכנית שלנו.


הגברת PCR והפצת שגיאות - ביולוגיה

qPCR מורכב יותר ממה שנתפס על ידי מדענים רבים.

ייצור של עקומת הגברה וערך מחזור כמותי משויך לא אומר בהכרח נתונים הניתנים לפירוש.

הנחיות ה-MIQE ומאמרי המתודולוגיה הנלווים שפורסמו לאחר מכן, מדגישים את הדחף המתמשך לעזור למדענים לייצר נתונים ניתנים לשחזור מ-qPCR, ששיאם במתודולוגיה פשוטה, צעד צעד, כדי להבטיח נתונים באיכות גבוהה וניתנים לשחזור מניסויי qPCR.

הרעיון של נורמליזציה של נתונים הוביל לפרסום מתמשך של מאמרים המתמקדים אך ורק בנושא זה עבור סוגי דגימות ופרמטרים ניסויים שונים.

הניתוח של נתוני qPCR יכול להיות מאתגר, במיוחד כאשר הניסויים גדלים במספר המדגם ובמורכבות הקבוצות הביולוגיות. גישה מוגדרת לניתוח נתונים qPCR נחוצה כדי להבהיר ניתוח ביטוי גנים.

PCR כמותי (qPCR) היא אחת הטכניקות הנפוצות ביותר לכימות מולקולות חומצת גרעין בדגימות ביולוגיות וסביבתיות. למרות שהמתודולוגיה נתפסת כפשוטה יחסית, ישנם מספר שלבים וריאגנטים הדורשים אופטימיזציה ואימות כדי להבטיח נתונים ניתנים לשחזור המשקפים במדויק את השאלות הביולוגיות המוצגות. מאמר סקירה זה מתאר וממחיש את המלכודות הקריטיות ומקורות השגיאה בניסויי qPCR, יחד עם תהליך קפדני, צעד צעד כדי למזער את השונות, הזמן והעלות ביצירת נתונים באיכות פרסום הניתנים לשחזור בכל פעם. לבסוף, מתוארת גישה לבחירה מושכלת בין טכנולוגיות qPCR ו- PCR דיגיטליות.


הגברת הגנום השלם (WGA)

רוב התאים מכילים רק עותק אחד או כמה מהגנום שלהם, המהווים פיקוגרמות של DNA, מה שלא מספיק לניתוח ישיר עם טכנולוגיות רצף קיימות. בדיקת DNA של תא בודד לצורך אבחון, שיכולה לדרוש ניסויים מרובים עם דגימה מוגבלת, דורשת גם הגברה מהירה ללא משוא פנים. המחקר על DNA עתיק, שלעתים קרובות מקוטע, מציב אתגר מסוג נוסף. אלו הם אזורים שבהם נעשה שימוש בטכנולוגיית הגברה איזותרמית להגדלת חומר ה-DNA הדרוש לניתוח במורד הזרם.

כדי להגדיל את כמות יעדי ה-DNA המוגבלים, הגברה איזותרמית של הגנום השלם (WGA) היא הטכניקה היעילה ביותר.[3] זה שימושי במיוחד בחקר מחלות גנטיות, שבו נדרשות חזרות רבות. DNA מוגבר על ידי WGA משמש בריצוף של הדור הבא במורד הזרם, ריצוף Sanger, גנוטיפ עם מיקרו-מערכים וגנוטיפים של פולימורפיזם נוקלאוטיד בודד (SNP).[4] פותחו טכניקות WGA שונות שנבדלות הן בפרוטוקולים והן בקלות השימוש שלהן.

Phi29 DNA פולימראז הוא האנזים העיקרי המועדף עבור WGA. Thermo Scientific מציעה גם משופר EquiPhi29 DNA פולימראז, שהוא מוטנט Phi29 DNA פולימראז קנייני שפותח באמצעות בַּמַבחֵנָה אבולוציה של חלבון.[5] אנזים זה עדיף באופן משמעותי על Phi29 ביציבות תרמו של חלבון, מהירות תגובה, תפוקת מוצר והטיית הגברה. יתר על כן, הוא שומר על כל היתרונות של האנזים הפראי, כולל עיבוד גבוה (עד 70 קילובייט), פעילות חזקה של עקירת גדילים ופעילות 3'–5' אקסונוקלאז (הגהה). מסיבה זו, מומלצים פריימרים אקראיים עמידים לאקסו. שולחן 3 משווה בין פולימראזות DNA קלאסיות של Phi29 ו-EquiPhi29.

טבלה 3. השוואה של פולימראזות DNA Phi29 ו-EquiPhi29 עם נתונים תומכים.

פולימראזות DNA מסוג Phi29EquiPhi29 DNA Polymerase
תהליכיות/עקירת גדיליםגבוה (עד 70 קילובייט)גבוה (עד 70 קילובייט)
טמפרטורת הגברה אופטימלית30-37 מעלות צלזיוס42-45 מעלות צלזיוס
זמן תגובהאיטי - עד 12 שעותאיטי - עד 3 שעות
הַגָהָה3'–5' (שיעורי שגיאה נמוכים)3'–5' (שיעורי שגיאה נמוכים)
דיוקגבוה (שיעורי שגיאה נמוכים)גבוה (שיעורי שגיאה נמוכים)
תְשׁוּאָהגָבוֹהַגבוה מאוד
הטיית רצף (העדפה)הגברה אחידה ומוטה נמוכה של שברים ארוכים (גנום שלם)הטיה נמוכה מאוד, כולל GC ו-AT עשיר (נתונים תקפים עבור חומר מוצא של 0.5 ng)

השוואת שיעורי שגיאה במהלך תגובת שרשרת פולימראז על ידי DNA פולימראז

ככל שפרויקטי שיבוט בקנה מידה גדול יותר הופכים נפוצים יותר, יש צורך גובר בהשוואות בין פולימראזות DNA בנאמנות גבוהה המשמשים להגברת PCR. כל הפולימראזות המשווקות עבור יישומי PCR נבדקות עבור תכונות נאמנות (כלומר, קביעת שיעור שגיאות) על ידי ספקים, ודוחות ספרות רבים התייחסו לנאמנות אנזים PCR. אף על פי כן, לעתים קרובות קשה לבצע השוואות ישירות בין אנזימים שונים בשל הבדלים מתודולוגיים ואנליטיים רבים ממחקר למחקר. מדדנו את שיעורי השגיאה עבור 6 פולימראזות DNA הנפוצות ביישומי PCR, כולל 3 פולימראזות המשמשות בדרך כלל עבור יישומי שיבוט הדורשים נאמנות גבוהה. ערכי מדידת שיעור שגיאה המדווחים כאן התקבלו על ידי רצף ישיר של מוצרי PCR משובטים. האסטרטגיה המופעלת כאן מאפשרת חקירה של שיעור השגיאות על פני מרחב רצף DNA גדול מאוד, שכן 94 יעדי DNA ייחודיים שימשו כתבניות עבור שיבוט PCR. ששת האנזימים שנכללו במחקר, טאק פולימראז, AccuPrime-Taq High Fidelity, KOD Hot Start, משובט Pfu פולימראז, Phusion Hot Start, ו Pwo פולימראז, אנו מוצאים את שיעורי השגיאות הנמוכים ביותר עם Pfu, Phusion, ו Pwo פולימראזות. שיעורי השגיאה דומים עבור 3 האנזימים הללו והם >10x נמוכים משיעור השגיאה שנצפה עם טאק פולימראז. מדווחים על ספקטרום של מוטציות, כאשר שלושת האנזימים בעלי נאמנות גבוהה מציגים סוגים דומים של מוטציות. עבור אנזימים אלה, מוטציות מעבר שולטות, עם הטיה קטנה שנצפה לסוג המעבר.

1. הקדמה

עם הקצב המהיר של ההתפתחויות במחקר המבוסס על ביולוגיה של מערכות, למשל, גנומיקה, פרוטאומיקה ומטבולומיקה, פרויקטים של גילוי ביולוגי בקנה מידה גדול יותר הופכים נפוצים יותר. במילים אחרות, היקפם של פרויקטים רבים השתנה ממחקר של יעד אחד/מעט למחקר של מאות, אלפים או יותר. דוגמה למחקר שעבר טרנספורמציה על ידי התפתחויות בביולוגיה של מערכות היא שיבוט של מסגרות קריאה פתוחות (ORFs) ממצעי cDNA. הנתיב המסורתי לשיבוט ORF התחיל בדרך כלל בתצפיות ניסיוניות המניעות את הזיהוי של גן אחד או כמה גנים שמעניינים מסלול מסוים. שיבוט של מטרות הביא בדרך כלל לשכלולים נוספים של פרטי המסלול ולעיתים קרובות זיהוי של יעדי שיבוט חדשים. עם היצירה והשכלולים המתמשכים של מסדי נתונים של רצפים גנומיים, שיבוט מתרחש כעת לעתים קרובות בקנה מידה גדול בהרבה. פריצות דרך של טכנולוגיית Microarray ורצף DNA הובילו לעלייה עצומה במספר ה-ORFs הקיימים במאגרי מידע ביולוגיים. יתרה מזאת, תצפיות ביולוגיות כבר לא בהכרח קודמות לזיהוי יעדים, שכעת מונעים לרוב על ידי תחזיות וניתוחים מבוססי ביואינפורמטיקה. דוגמאות למאמצי שיבוט בקנה מידה גדול כוללות פרויקטים של גנומיקה מבנית לקביעה שיטתית של מבני חלבון [1], שיבוט ORF של פתוגן להבנת מחלות ומנגנונים טיפוליים [2], ויצירת ה-ORFeome האנושי כולו אשר יוסיף התפתחויות במדעים ביו-רפואיים בסיסיים ויישומיים [3].

פולימראזות DNA המשמשות להגברת מטרות במהלך שיבוט PCR הם אנזימים בעלי נאמנות גבוהה עם תדרי שגיאה בדרך כלל בטווח של

מוטציות/bp מוגבר [4]. מזעור שגיאות שנוצרו על ידי PCR חשוב במיוחד עבור פרויקטים של שיבוט בקנה מידה גדול יותר, מכיוון שבהינתן מאגר גדול מספיק של רצף DNA מטרה, אפילו אנזימים בעלי נאמנות גבוהה ייצרו שיבוטים עם מוטציות. ישנן מגוון שיטות לבחון את הנאמנות של פולימראז DNA. עם זאת, תדירות שגיאה של אנזימי PCR נבדקת כמעט תמיד באמצעות יעד DNA מוגדר אחד (או כמה) שדוגם חלק מוגבל של מרחב רצף ה-DNA. מחקרים מוקדמים המשתמשים בנאמנות נמוכה יחסית טאק DNA פולימראז הסתמך על רצף של מוצרי PCR משובטים (למשל, [5, 6]). רצף ישיר של שיבוטים היה גישה מעשית באותה תקופה בשל הנאמנות הנמוכה של הפולימראז כלומר, רוב השיבוטים שנרשמו יכילו לפחות מוטציה אחת.

עם כניסתם של פולימראזות נאמנות גבוהה יותר, פותחו שיטות סקר חדשות כדי לחקור במהירות מספר גדול של מוצרי PCR לנוכחות מוטציות. מבחני אלו התבססו על בדיקת נאמנות מוטציה קדימה שפותחה על ידי Kunkel ועמיתיו, שהשתמשה בתגובה מילוי פערים עם פולימראז DNA על lacZ רצף תבנית, ואחריו קשירה והתמרה לתוך אי - קולי. הקרנה קולורימטרית על בסיס פונקציונלי lacZ הגן איפשר זיהוי מהיר של מוטציות, אשר רצפו לאחר מכן כדי לקבוע את אופי השינוי ב-DNA [7]. נעשה שימוש בגישה דומה לסינון מוצרי PCR למוטציות, על ידי שיבוט א lacZ מקטע מוגבר על ידי PCR בניגוד למילוי פער פשוט על ידי פולימראזות DNA. שיטה זו, לעיתים תוך שימוש בגן ​​מדווח אחר, שימשה לסריקה של מגוון אנזימי PCR בנאמנות גבוהה וכדי לייעל את תנאי תגובת PCR כדי למזער מוטציות [4, 8]. לבסוף, שיטות המסתמכות על בדיקת מוטציות PCR המבוססות על תכונות כימיות שונות (כלומר טמפרטורת התכה) של תוצרי תגובה עם חוסר התאמה ביחס לדופלקסים מושלמים פותחו ויושלו על מגוון מערכות אנזימים [9, 10]. בעוד ערכי הנאמנות המדווחים שונים בין קבוצות מחקר ושיטות בדיקה, קיימת הסכמה כללית כי אנזים בעל נאמנות נמוכה יחסית, כגון טאק יש ערך נאמנות ב-

לאנזימי טווח ואמינות גבוהה יותר יש ערכים שנמצאים בטווח (בדרך כלל מדווחים כמוטציות ל-bp לכל הכפלת תבנית).

הפשרה הכרוכה בשימוש בשיטות סקר כמו אלו שתוארו לעיל היא שבדרך כלל רק רצף DNA אחד נחקר במהלך הבדיקה. בנוסף, מגבלות המובנות במבחנים מגבילות עוד יותר את המוטציות האפשריות שניתן לזהות. לדוגמה, הבדיקה המבוססת על הקרנה lacZ מוצרי הגברה של גנים משתמשים במטרה בודדת של 1.9 קילו-בייט, שמתוכם רק 349 בסיסים יפיקו שינוי צבע בעת מוטציה [11]. כמו כן, בדיקת מוטציות המבוססת על פרופילי התכה דופלקסים דיפרנציאליים מוגבלת לרצפי יעד ייחודיים קצרים מספיק, בדרך כלל בטווח של 100-300 bp, ובעלי פרופילי התכה תרמית המאפשרים פתרון של אי-התאמה בודדת [9, 10].

מכיוון שידוע כי שגיאות פולימראז תלויות מאוד בהקשר של רצף ה-DNA (נבדק ב-[12]), באופן אידיאלי יש להשתמש בקבוצה גדולה של רצפי DNA בעת מדידת נאמנות האנזים. זה הופך להיות רלוונטי במיוחד בהקשר של פרויקטים של שיבוט בקנה מידה גדול, הכוללים מאות או אלפי מטרות ובכך מכילים מרחב רצף DNA כמעט אינסופי. לשם כך, תכננו ויצאנו לפועל מחקר שמודד את נאמנות האנזים על ידי רצף ישיר של מוצרי PCR משובטים. ירידה בעלויות עבור רצף DNA הפכה שיטה זו של קביעת נאמנות למעשית, אפילו עבור אנזימים שעושים מעט טעויות. המטרות שלנו הן להשוות ערכי נאמנות שמקורם ברצף שיבוטים ישיר לאלו שנגזרו משיטות מבוססות סקר, וכן להעריך תוצאות אלו בהקשר של בחירת אנזים לפרויקט שיבוט בתפוקה גבוהה.

2. תוצאות ודיון

כדי לקבוע שיעורי שגיאה ולבחון ספקטרום מוטציה עבור מגוון פולימראזות DNA המשמשות בשיבוט PCR, רצפנו ישירות שיבוטים שהופקו מ-94 תבניות פלסמיד שונות. פלסמידים אלו, כל אחד עם רצף DNA מטרה ייחודי, הם תת-קבוצה של קבוצה גדולה יותר של שיבוטים של גליקוזילטרנספראז שהכנו מ Arabidopsis thaliana cDNA (כתב יד בהכנה). ל-94 הפלסמידים יש תוספות בגודל הנעים בין 360 bp ל-3.1 kb (חציון 1.4 kb) ותכולת GC נעה בין 35% ל-52% (חציון 44%). סיכום של 6 הפולימראזות של DNA בשימוש במחקר זה מוצג בטבלה 1. כללנו טאק פולימראז במחקר שלנו בגלל גוף הספרות הנרחב שקיים על תכונות הנאמנות של אנזים זה. האנזימים האחרים הכלולים כולם מסווגים בדרך כלל כ"נאמנות גבוהה" ולכן הם מועמדים פוטנציאליים לפרויקטי שיבוט בקנה מידה גדול. ובעוד שהשוואת ערכי נאמנות קשה בגלל הבדלים בשיטות בדיקה וכימות בין מחקרים שונים, נראה שדירוג כללי של האנזימים שנחקרו כאן (הנאמנות הנמוכה ביותר לגבוהה ביותר) הוא טאק < AccuPrime-טאק < KOD

Pfu Pwo < Phusion.

צינור השיבוט שלנו משתמש בהחדרה מחדש של מוצרי PCR מטוהרים לוקטור פלסמיד באמצעות מערכת השיבוט Gateway, שיטה בשימוש נרחב למחקרי שיבוט בתפוקה גבוהה (נסקרה ב-[17]). מכיוון שתבניות ה-DNA של פלסמיד הקלט שלנו הוכנו באמצעות מערכת ה-Gateway, גני היעד המעניינים כולם מוקפים על ידי att רצפי ריקומבינציה. זה אפשר את השימוש בפריימרים משותפים לכל תגובות ה-PCR, ובכך מבטל את הצורך באופטימיזציות ספציפיות למטרה. נעשה שימוש ב-DNA פלסמיד מטוהר כתבנית עבור PCR, ובכל המקרים נעשה שימוש במאגרים המומלצים על ידי הספק. השתמשנו בכמויות קטנות של תבנית פלסמיד (25 pg/rxn), על מנת למקסם את מספר ההכפלות בתגובת ה-PCR, וגודל ההכנסה ביחס לגודל הפלסמיד הכולל נלקח בחשבון כדי לקבוע את כמות שברי המטרה הקיים ב התבנית. פרוטוקול ה-PCR השתמש ב-30 מחזורי הגברה, עם זמן הארכה של 2 דקות/מחזור עבור מטרות ≤2 kb (82 מתוך 94 מטרות) ו-4 דקות/מחזור עבור מטרות >2 kb (12 מתוך 94 מטרות). איור 1 מציג תמונות ג'ל עבור קבוצה מייצגת של תגובות PCR עבור כל אנזים. בכל המקרים, נצפתה רצועת מוצר מרכזית יחידה שנדדה בגודל הצפוי. יעילות ההגברה נמדדה על ידי כמות של מוצר PCR באמצעות צבע ספציפי ל-dsDNA וחישוב ההגברה של קיפול על סמך כמות ידועה של תבנית DNA קלט. ההגברה של הקיפול משמשת לקביעת מספר הכפלות התבנית שהתרחשו במהלך PCR. כפי שדווח בטבלה 2, ערכי יעילות ההגברה היו אחידים למדי עבור כל הדגימות בתוך צלחת. אנו רואים יעילות הגברה דומות בין אנזימים שונים, למעט העובדה שבדרך כלל ראינו פחות הכפלות של תבניות בתגובות עם Pfu פולימראז. שמרנו על פרוטוקולי תרמומחזור קבועים עבור כל האנזימים, ולכן ייתכן שחלק מהפרמטרים לא היו אופטימליים להגברה על ידי Pfu.

) הוא הממוצע של ערכי הכפלה עבור כל אחת מ-94 תגובות ה-PCR בצלחת אחת, כאשר הכפלות מחושבות מהנוסחה

= (ng DNA לאחר קלט PCR/ng DNA). שיעור שגיאות (ו) מחושב כ ו =

הוא מספר המוטציות שנצפו עבור כל השיבוטים שנרשמו וה-(גודל יעד ×

עבור כל מטרה שהושבטה.


תמונות אלקטרופורזה נציגות של אגרוז ג'ל של תוצרים של הגברה של PCR של 24 יעדי DNA ייחודיים, תוך שימוש בשישה אנזימים שונים. כל נתיב מכיל 1/25 מתגובת PCR כולה. גדלי המוצרים הצפויים נעים בין 1.4 ל-1.7 קילובייט בגודל.

לאחר ההגברה, מוצרי PCR טוהרו על ידי משקעים עם PEG/MgCl2, הידוע כמפרק את ה-DNA באופן סלקטיבי על בסיס גודל [18], כדי להסיר מוצרים קצרים בגודל של <300 bp. שלב משקעים זה יכול להתבצע בפורמט של צלחת 96 באר, שהיא דרישה כאשר מספר הדגימות הופך גדול. אימצנו את הפרוטוקול הזה לשימוש שגרתי וראינו יעילות גבוהה יותר להחדרת DNA בגודל נכון לוקטור בהשוואה לטיהור באמצעות טיהורי PCR מבוססי ערכה, שבדרך כלל יש להם חתכים בגודל של

100 bp (נתונים לא מוצגים). במקרה שבו קיימים מוצרי PCR מחוץ למטרה של >300 bp, מיצוי ג'ל משמש כדי לבודד את המוצר הרצוי. מוצרי PCR מטוהרים הודגרו עם DNA וקטור ו-BP Clonase II והומרו לתאים מוכשרים. שלוש מושבות לצלחת נאספו וגודלו בצלחות של 96 בארות, ותרביות נבדקו להכנסת גודל נכון על ידי PCR של מושבה. ערכי יעילות ההחדרה של BP Clonase II, מבוטאים כמספר הממוצע של שיבוטים בעלי הוספה ב/קרוב לגודל הצפוי (מתוך 3 מושבות שנבדקו בכל טרנספורמציה), היו בדרך כלל 80-90% (נתונים לא מוצגים). עבור כל מטרה, שיבוט אחד או יותר עבור כל מטרה המכיל הוספה בגודל הנכון (אם הושג) תורבת והשתמשו לרצף DNA.

למטרות אימות השיטה, השתמשנו טאק DNA פולימראז, פולימראז DNA משפחתי A והאנזים בשימוש בניסויי PCR המוקדמים ביותר [6]. כסוס עבודה מוקדם בטכנולוגיית PCR, טאק פולימראז נחקר בהרחבה למטרות קביעת נאמנות. טאק DNA פולימראז חסר פעילות אקסונוקלאז 3′→5′ ולכן אינו מסוגל לתקן נוקלאוטידים ששולבו בצורה שגויה המתרחשים במהלך סינתזת ה-DNA. בדיקות שונות שימשו לבדיקה טאק נאמנות, ובהתאם לשיטה שבה נעשה שימוש, ערכי שיעור שגיאה (מבוטאים כמוטציות לכל זוג בסיסים לכל שכפול תבנית) עבור טאק טווח פולימראז מ

(למשל, [7, 20]). יתר על כן, הספקטרום המוטציוני של טאק פולימראז אופיינה, כאשר מעברי A•T → G•C שולטים בשל הנטייה של האנזים לשלב באופן שגוי dCTP נכנס עם נוקלאוטיד טימין תבנית [6, 9, 21].

על ידי רצף ישיר של שיבוטים משני ניסויי PCR עצמאיים עם טאק פולימראז, ראינו 99 מוטציות ייחודיות מתוך >100 kbp של רצף DNA מטרה. הסוג והמספר של מוטציות בודדות מפורטים בטבלה 3. בהתחשב ביעילות ההגברה של כל תגובת PCR, שיעור השגיאות (ממוצע של 2 ניסויים) עבור טאק פולימראז הוא

מוטציות / bp לכל שכפול תבנית. ערך זה עולה בקנה אחד עם ערכים אחרים שפורסמו עבור אנזים זה, והשונות הגבוהה יחסית מצביעה על כך שערכי שגיאה מחושבים הנבדלים עד פי 2 כנראה אינם משמעותיים ביחס לרעש הניסוי. רוב המוטציות (67 מתוך 99) הן מעברי A•T → G•C, שעלולים לנבוע מהתאמה שגויה של dCTP נכנסת עם תבנית A או התאמה שגויה של dGTP נכנסת עם תבנית T. מעברים מסוג G•C →A•T , הנובעים מהתאמה שגויה של TTP נכנסת עם תבנית G או התאמה שגויה של dATP נכנסת עם תבנית C, הן המוטציה השנייה בשכיחותה (28 מתוך 99). היו 3 מוטציות טרנסברסיה, עם 1 A•T→T•A ו-2 A•T→C•G שינויים. בסך הכל, הספקטרום של מוטציות החלפת הבסיס תואם היטב עם תצפיות קודמות בנושא טאק פולימראז שדווח בספרות [7]. נצפתה רק מוטציה אחת או מחיקה (indel) אחת במערך הנתונים שלנו, מחיקת T בודדת ב-

רצף תבניות. טאק דווח כי פולימראז מייצר מוטציות אינדל בתדירות משמעותית, עד לכ-25% מסך המוטציות, כאשר כולן מתרחשות בריצות הומופולימריות [7]. מכיוון שמאגר היעד שלנו מכיל 1481 מקרים של ריצות הומופולימר של לפחות 4 bp, אנו חושדים שהבדלים אחרים בין תנאי הבדיקה הקודמים לאלה ששימשו כאן מסבירים את הפער. באופן ספציפי, הניסויים המוקדמים יותר בוצעו עם מגנזיום מוגבר (10 מ"מ לעומת 1.5 מ"ל בשימוש כאן) ורמות dNTP מוגברות (1 מ"מ לעומת 0.2 מ"מ בשימוש כאן). שני רמות מגנזיום ו-dNTP מוגברות הוכחו לאחר מכן כמגבירות מוטציות מסגרת (indel) בהעדפה ביחס למוטציות החלפת בסיס [21].

בקרה חשובה עבור ניסויים אלה נדרשת על ידי השיטה המשמשת ליצירת תבנית לרצף DNA. עבור פרויקטים של שיבוט בקנה מידה גדול יותר, ריצוף DNA באמצעות תרבית תאים הוא יתרון בגלל החיסכון בזמן ובמשאבים ביחס לטיהור DNA פלסמיד. עם זאת, ריצוף באמצעות תרבית תאים מצריך PCR או שלב הגברה אחר, ושלב זה יכול להיות באופן עקרוני מקור ל"מוטציה נוספת". כדי לטפל בזה באופן ישיר, רצפנו DNA של miniprep שהוכן מתת-קבוצה של שיבוטים שנוצרו עם טאק פולימראז. כל אחת מארבע עשרה המוטציות שזוהו בתת-הקבוצה באמצעות תרבית תאים כמקור לתבנית רצף נצפתה גם בעת ביצוע רצף מתבנית DNA של פלסמיד (נתונים לא מוצגים). אנו מסיקים כי לשיטה שלנו יש שיעור חיובי שגוי של <7% (1/14) והיא מקובלת לבדיקת מוטציות הנגרמות על ידי PCR. יתר על כן, בהתבסס על התוצאות שלנו עם טאק פולימראז, אנו מסיקים שהשיטה שלנו לקביעת נאמנות נותנת תוצאות בהסכמה מצוינת עם מחקרים אחרים ולכן היא מדד מדויק לדיוק הפולימראז.

התוצאות שלנו מצביעות על כך ש-3 מהאנזימים שנכללו במחקר, Pfu פולימראז, Phusion Hot Start, ו Pwo פולימראז, בעלי שיעורי שגיאה נמוכים משמעותית מהאחרים. זה עולה בקנה אחד עם ממצאים קודמים שהדגימו הגברת PCR בנאמנות גבוהה מאוד עבור אנזימים אלה. באופן מעניין, ערכי תדירות השגיאה עבור שלושת האנזימים הללו דומים מאוד זה לזה, בערך 2-3 × מוטציות/bp/תבנית הכפלה. ההבדלים הקלים בתדירות השגיאה אינם משמעותיים ככל הנראה, בהתחשב בכך שמספר המוטציות הקטן מיוצר על ידי פולימראזות אלה בנאמנות גבוהה בנוסף לשונות הניסויית שנדונה לעיל עבור התוצאות עם טאק. בהתחשב בעלויות השיבוט והרצף ותקציבי מחקר סופיים, זיהוי מוטציות על ידי רצף DNA של שיבוטים מייצר מערך נתונים קטן יחסית של מוטציות כאשר נאמנות האנזים גבוהה. זהו חיסרון לבדיקה שלנו, ולמרות העובדה שעלויות ריצוף ה-DNA ממשיכות לצנוח חיידקי ההקרנה היא עדיין שיטה חסכונית הרבה יותר לחקור מספר רב של שיבוטים. עבור כל השיבוטים המוטנטים המיוצרים על ידי Pfu, Phusion Hot Start, ו Pwo פולימראזות, דגימות רוצו מחדש כדי לשלול עיבוד דגימה או רצף DNA כמקור שגיאה. בכל המקרים, המוטציה המקורית הייתה קיימת, מה שמאשר את תגובת ה-PCR כמקור הסביר ביותר למוטציה. מנקודת המבט של שימוש בפרויקט שיבוט בקנה מידה גדול, כל אחד מהאנזימים הללו יהיה מקובל, בהתבסס על הקריטריונים של מזעור שיעור השגיאות. יש לקחת בחשבון כמובן גורמים אחרים, כגון יעילות הגברה, ספקטרום מוטציות, ביצועים עם תבניות תוכן GC גבוה, ועלות, אם להזכיר כמה. בכל הנוגע לספקטרום המוטציות, שלושת הפולימראזות בנאמנות גבוהה יצרו כולם בעיקר (>75%) מוטציות מעבר, ללא הטיה משמעותית של תבנית. עם אנזים Phusion, ראינו 15% (2/13) מוטציות אינדל, שהן בעייתיות עבור יישומי שיבוט שבהם יש לשמור על מסגרת קריאת תרגום. שתי מוטציות האינדל התרחשו באזורים חוזרים, כאשר אחת מהן היא הכנסת A לתוך an

רצף תבנית והשני הוא מחיקה (TCT) בתוך a

רצף תבניות. תוצאה זו הייתה בלתי צפויה לאור התהליכים הגבוהים של Phusion polymerase ביחס לאנזימי PCR נפוץ אחרים (אתר הספק). מכיוון שמחקרים מרובים מצאו שתהליכי פולימראז מוגברת מפחיתה את תדירות מוטציות ההחלקה שגורמות למוטציות אינדל [22, 23], ציפינו ש-Phusion תייצר הכי מעט שגיאות מסוג זה. עם זאת, יש לציין כי מסקנה זו מבוססת על גודל מדגם קטן ויש לנתח מספר רב יותר של מוטציות לצורך אישור.

היה מעניין אותנו שאף אחד מהאנזימים שנבדקו כאן לא התגלה כבעל שיעור שגיאה למטה

2 × . מחקרים אחרים בספרות דיווחו על תדירות שגיאה מתחת ל-10-6 עבור אנזימי PCR,

[10] עבור Pfu פולימראז נבדק על ידי דיפרנציאלי דופלקס TM מדידה ו-4.2 × עבור Phusion, באמצעות בדיקת HF-buffer בשיטה הנקראת BEAMING [16]. למחקר של נאמנות Phusion, ה-PCR השתמש במאגר שונה מזה המופעל כאן, מה שלפי הספק אכן מביא לשיעור שגיאות נמוך פי 2-3. בנוסף, מחקר זה משתמש בשיטת BEAMING, פרוטוקול ציטומטרי זרימה רגיש במיוחד המסנן מספר רב של חרוזים המכילים תוצרי PCR עבור נוכחות של וריאציות נוקלאוטידים. עם זאת, רק מוטציה ספציפית אחת, G•C → A•T מוטציה במיקום בודד, נחקרה באותו מחקר. לפיכך, בעוד שהבדיקה רגישה ביותר לזיהוי של מוטציות מוגדרות, תוצאות המתקבלות בשיטת BEAMING לתדירות מוטציות במיקום בודד עשויות שלא לשקף בהכרח את תכונות הנאמנות של אנזים עבור חללי רצף גדולים בהרבה. למחקר על Pfu שיעור השגיאות, קיימים מספר הבדלים מתודולוגיים בסיסיים: במחקר הקודם, ה-PCR בוצע בתנאים "כמעט אנאירוביים" עם זמני רכיבה קצרים משמעותית, גודל היעד הוגבל ל-93 bp, וזיהוי מוטציות הסתמך על שיטה פיזיוכימית: הפרדה ובידוד של מוצרי PCR המכילים אי התאמה על ידי אלקטרופורזה נימית [10]. ולמרות ששיטה זו שימשה בהצלחה בזיהוי של מוטציות נדירות בדגימות DNA מיטוכונדריאליות מרקמות נורמליות וסרטניות [24], הדרישה למוטציה שתגרום למולקולה עם פרופיל התכה שונה עשויה להטות את מספר המוטציות שיכולות להתגלות. אי התאמה גדולה בין התוצאות שלנו לאלו מהדוח הקודם הזה Pfu ניתן לראות נאמנות, אשר עשויה להיות קשורה למתודולוגיות השונות לגילוי מוטציות, בתוצאות ספקטרום המוטציות בטבלה 3. צפינו

90% (8 מתוך 9) מוטציות מעבר, עם הטיה קלה לשינויי G•C → A•T. לעומת זאת, המחקר באמצעות אלקטרופורזה קפילרית לזיהוי הביא לרוב (3/5) מוטציות טרנסורסיות, עם מעבר A•T → G•C בודד ומוטציית מחיקה בודדת של 1 bp. מוטציות טרנסורסיה מחייבות את הפולימראז לסנתז פורין•פורין או חוסר התאמה של פירמידין•פירמידין, שתיהן מועדפות באופן משמעותי ביחס לאי-התאמות הפורין•פירימידין השונות בפולימראזות משפחתיות B, כולל Pfu פולימראז [25, 26]. מכיוון שסוגי המוטציות שאנו צופים תואמים את ספקטרום המוטציה שדווחו בעבר עבור פולימראזות אחרות ממשפחת B, אנו מאמינים שהשיטה שלנו זיהתה שגיאות פולימראז בצורה נטולת הטיה.

שני האנזימים האחרים שנכללו במחקר שלנו, KOD פולימראז ו- AccuPrime-טאק High Fidelity, יש ערכי נאמנות ביניים טאק פולימראז ואנזימי הנאמנות הגבוהה יותר. שיעור השגיאה שנצפה עבור פולימראז של KOD היה בלבד

נמוך פי 4 מזה של טאק פולימראז ו

פי 2.5 יותר מאשר עבור Pfu פולימראז. הדו"ח הראשוני על נאמנות פולימראז KOD, פולימראז דמוי משפחה B/פולה Thermococcus kodakaraensis KOD1, דיווח על שיעור שגיאה מעט נמוך מאוד מ Pfu פולימראז ו

נמוך פי 4 מאשר עבור טאק פולימראז [13]. מחקר זה השתמש במבחן מוטציה קדימה (לא PCR), ביטא נאמנות פשוט כיחס בין מושבות לבנות לכחול ללא הסבר ליעילות הגברה של PCR, והשתמש בתנאים ניסיוניים (ריכוז Mg 2+) השונים באופן משמעותי מתנאי PCR טיפוסיים. מחקר שלאחר מכן שמודד נאמנות בתנאי PCR, תוך שימוש בגן ​​מדווח אחר אך עדיין יחס פשוט בין מושבות מוטציות לסוג פרא, דיווח על שיעורי שגיאה

נמוך פי 50 מאלה עם טאק ונמוכים במעט מאלו עבור Pfu פולימראז [14]. באף אחד מהמחקרים הללו לא היה דיווח על השינויים המולקולריים שהובילו למושבות מוטנטיות. ההבדל הגדול בין שתי התוצאות הללו, שהן מאותה קבוצת מחקר, משמש להדגיש את הקשיים בביצוע השוואות בין מחקרים שבהם יש הבדלים מתודולוגיים משמעותיים. במחקר הנוכחי, אנו מוצאים שספקטרום המוטציות של KOD פולימראז דומה לשאר הפולימראזות ממשפחת B (Pfu, Pwo, ו-Phusion) שנבדקו כאן. כפי שמוצג בטבלה 3, מעברים שולטים (14 מתוך 16 מוטציות), עם הטיה קלה (64%) למוטציות A•T → G•C.

עבור ה-PCR המבוצע עם AccuPrime-טאק מערכת High Fidelity, ראינו שיפור של פי 3 בנאמנות ביחס ל טאק פולימראז. לדברי הספק, AccuPrime-טאק High Fidelity היא תערובת אנזימים המכילה טאק פולימראז, חלבון משפר תהליכים, ופולימראז להגהה גבוהה יותר פירוקוקוס מִין GB-D. שיעור השגיאות הנמוך יותר שנראה עם AccuPrime-טאק ככל הנראה נובע מה GB-D טעויות עריכת פולימראז שהוצגו על ידי טאק פולימראז בניגוד לתהליכים משופרים מאחר שלתהליך מוגברת הוכח שאין השפעה משמעותית על שגיאות החלפת בסיס [22, 27]. ספקטרום המוטציות של התערובת כמעט זהה לזה שנראה עם טאק פולימראז לבדו, עם מעברים דומיננטיים והטיה משמעותית לשינויי A•T → G•C (71% עבור AccuPrime-טאק לעומת 73% עבור טאק). עם זאת, יש לציין כי מחקר על ספקטרום המוטציות של GB-D DNA פולימראז (זמין מסחרית כ-Deep Vent) מצא שמעברי A•T → G•C הם המוטציה השולטת [28]. ניתוח מפורט על התרומה של כל אנזים לספקטרום המוטציות הכולל נמנע גם על ידי ניסוח האנזים הקנייני המשמש את הספק.

לסיכום, השתמשנו בריצוף DNA ישיר של מוצרי PCR משובטים כדי לבחון את נאמנות הפולימראז ולהעריך היבטים אחרים של התאמת האנזים לפרויקטים של שיבוט בקנה מידה גדול. בהתבסס על מזעור שגיאות PCR, Pfu פולימראז, Pwo פולימראז ו-Phusion כולם מייצרים רמות נמוכות מקובלות של מוטציות. נצפה כי Phusion מייצר יותר מוטציות אינדל מאשר Pfu אוֹ Pwo פולימראזות, אם כי המספר הכולל של המוטציות היה מוגבל. סוג זה של מוטציה בעייתי במיוחד עבור פרויקטים של שיבוט ORF ויש לקחת אותו בחשבון בתהליך בחירת האנזים. מלבד שיקולי נאמנות, ערכי יעילות ההגברה היו גבוהים משמעותית עבור Phusion ו Pwo לְעוּמַת Pfu, אם כי אופטימיזציה נוספת של תגובת PCR עבור Pfu סביר להניח שישפר את ערכי היעילות. כמו כן, עבור פרויקטים של שיבוט שבהם המטרות הן או ארוכות מאוד או עשירות מאוד ב-GC עשויה להיות חשיבות נמוכה יותר ביחס ליכולת להגביר את ה-DNA של המטרה "קשה". ולבסוף, מכיוון שמרחב היישומים לטכנולוגיית PCR הוא עצום, כאשר שיבוט מייצג רק חלק קטן, יש להשוות ולהעריך אנזימים אחרים מאלה שנלמדו על סמך צרכים ואתגרים ספציפיים לפרויקט.

3. חומרים ושיטות

3.1. תגובות PCR

כל האנזימים ומאגרי התגובה היו ממקורות מסחריים: Fermentas (טאק פולימראז), Invitrogen/Life Technologies (AccuPrime-טאק), EMD Chemicals/Novagen (KOD Hot Start), Agilent (משובט Pfu פולימראז), Finnzymes (Phusion Hot Start), ו-Roche (Pwo פולימראז). תגובות PCR בוצעו בנפח סופי של 50 μL באמצעות תנאי חיץ וכמויות אנזימים המומלצות על ידי הספק. עבור תגובות עם Phusion, נעשה שימוש במאגר GC. בכל המקרים, התגובות כללו 0.2 mM כל dNTP (Fermentas) ו-0.2 mM כל פריימר (IDT) עם הרצפים (5′ עד 3′) GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC לפריימר קדימה ו-GGGGACCACTTTGTACAAGAAAGCTGGGTC עבור ה-Reverse primer. התבנית לתגובות PCR הייתה מיני-prep פלסמיד DNA, כאשר כל תבנית פלסמיד מכילה רצף יעד ייחודי של רצף וגודל ידועים, הנעים בין 0.3 ל-3 kb. הוספת המטרה שובטה בין ה att אתרים של וקטור pDONR, המאפשרים שימוש בערכת פריימר משותפת לכל הפלסמידים. כל תגובת PCR הכילה 0.025 ננוגרם פלסמיד DNA, שנמדד באמצעות ריאגנט לכימות ה-DNA PicoGreen (Invitrogen/Life Technologies), ובכך את כמות יעד הקלט (אני) חושב כ

ng (גודל המטרה ÷ (גודל המטרה + גודל הפלסמיד)). פרוטוקול התרמו-מחזור לכל התגובות עם אורך יעד ≤2 kb היה 5 דקות, 95°C, לאחר מכן 30 מחזורים של 15 שניות, 95°C → 30 שניות, 55°C →2 דקות, 72°C, ולבסוף 7 דקות בשעה 72 מעלות צלזיוס. עבור היעדים בגודל >2 kb, שלב ההארכה של 2 דקות הוארך ל-4 דקות. לניתוח מוצרי PCR על ידי ג'ל, 2 μL של כל תגובת PCR הופעל על 2% agarose eGel (Invitrogen/Life Technologies) על פי המלצות הספק.

3.2. כמות של תגובות PCR

יעילות הגברה של PCR נקבעה על ידי מדידת כמות המוצר באמצעות בדיקת כמות שונה של PicoGreen dsDNA. שיטה זו הופעלה על ידי אופטימיזציה של תגובת ה-PCR לייצור פס מוצר יחיד (איור 1). שימוש במערכת אוטומטית להעברת נוזלים של Biomek FX-P (בקמן), 5 μL של כל תגובת PCR היה מדולל פי 50 במאגר TE (pH 8) לתוך צלחת חדשה עם 96 בארים. מהצלחת הזו, 5 μL מכל באר היה מעורבב עם 195 μL של תמיסת PicoGreen, דילול פי 500 של צבע ב-TE (pH 8). מדידות הקרינה נלקחו עם קורא לוחות Paradigm (בקמן). קרינת רקע נקבעה מתגובת PCR שלא הכילה DNA תבנית. לאחר חיסור רקע, ריכוז ה-DNA נקבע על ידי השוואת קריאות הקרינה לאלו שהתקבלו עם עקומה סטנדרטית באמצעות DNA בריכוז ידוע שסופק עם הצבע. היקף הגברת המטרה (ה) מחושב כ ה = (ng DNA לאחר PCR) ÷ (ng של קלט DNA יעד), ומספר הכפלות התבנית במהלך PCR (ד) ניתן לחשב כ

3.3. שיבוט מוצרי PCR

תגובות PCR טוהרו בפורמט צלחת של 96 בארות על ידי הוספת PEG 8000 ו-MgCl2 לריכוזים סופיים של 10% ו-10 מ"מ, בהתאמה, ישירות לכל באר של צלחת ה-PCR באמצעות פיפטור רב-ערוצי. הצלחת הסתובבה ב-4000 סל"ד למשך 60 דקות בטמפרטורת החדר, והסופרנטנט הושלך. הכדורים נשטפו פעמיים באיזופרופנול קר, ייובשו באוויר והושעו מחדש ב-25 μL TE (pH 8). פרוטוקול זה הביא לתשואות מצוינות (50-75%) של מוצרי PCR, ללא מוצרים <300 bp, כפי שנבחן על ידי אלקטרופורזה ג'ל. מוצרי PCR מטוהרים שובטו לתוך וקטור pDONR223 (מתנה נדיבה של ד"ר דומיניק אספוסיטו וג'ים הארטלי, NCI, פרדריק, MD) באמצעות BP Clonase II (Invitrogen/Life Technologies). תגובות Clonase הורכבו באמצעות פיפטור רב-ערוצי בצלחות PCR 96 בארות ב-5 μנפח L והכיל 75 ננוגרם pDONR223, 1 μL מוצר PCR מטוהר (בדרך כלל 50-150 ng DNA), ו-1 μL BP Clonase II. צלחות אטומות הודגרו לפחות 16 שעות ב-25 מעלות צלזיוס, ו-1 μL של כל תגובה שימש באופן מיידי (ללא טיפול ב-Proteinase K) לשינוי 25 μL או 50 μL של תאי TOP10 מוכשרים (Invitrogen/Life Technologies). בעקבות הלם חום והתאוששות, לאחר תוספת של 250 μL of SOC media, 100 μL של תאים היה מצופה על צלחות LB המכילות 50 מ"ג/מ"ל ספקטינומיצין. מספרים מקבילים של מושבות נצפו בטרנספורמציות באמצעות 25 μL או 50 μL של תאים מוכשרים קפואים, ותגובות BP בקרה חסרות BP Clonase II או מוצר PCR הובילו ללא טרנספורמנטים.

3.4. הקרנת טרנספורמנטים

שלוש מושבות מכל צלחת טרנספורמציה נאספו ותופחו בצלחות 96-בארות (Costar 3788) אטומות בממברנה חדירה לגז, כאשר כל מושבה הודגרה ב-150 מ"ל של מדיה LB עם 50 מ"ג/מ"ל ספקטינומיצין ו-10% גליצרול. לאחר דגירה של לילה ב-37 מעלות צלזיוס (ללא ניעור), 1 μL של כל תרבית שימש לסינון על ידי מושבה PCR עבור נוכחות של הכנסה עם גודל צפוי. תגובות PCR של המושבה (25 מ"ל) השתמשו באותם פריימרים המשמשים לשיבוט בריכוז סופי של 0.1 מ"מ כל אחד, עם 30 מחזורי הגברה כמתואר לעיל, עם GoTaq פולימראז (פרומגה). התגובות נותחו על ידי אלקטרופורזה של ג'ל אגרוז, והנוכחות של פס בגודל הצפוי או בסמוך לו צוינה כ"מכה". מספר הפגיעות (0-3) עבור כל מטרה נקבע, ומספר ממוצע של פגיעות לכל מטרה עבור כל צלחת נקבע והשתמשו כמדד ליעילות התגובה של Clonase.

3.5. רצף שיבוטים

במקרים בהם ערכי יעילות Clonase היו >66%, ממוצע של לפחות 2 כניסות מתוך 3 מושבות שנבדקו, כל צלחת התרבות הנוזלית שוכפלה עם משכפל 96 פינים על גבי צלחת אגר עם אותם ממדים כמו צלחת 96 בארות. הצלחת הוגשה מיד לספק חיצוני (Quintarabio, ברקלי, קליפורניה), ולאחר גידול לילה בוצע רצף על DNA מוגבר מכל שיבוט. אם ערכי היעילות של Clonase היו <66% (טאק ו Pfu תגובות פולימראז), נוסף שלב במערך האחורי, באמצעות רובוט קטיף מושבות Qpix2 (Genetix) כדי למקסם את מספר השיבוטים עם הוספה בגודל הנכון על צלחת אחת. להשוואת תוצאות רצף באמצעות תאים לעומת DNA miniprep, צלחת אחת של מושבות שנבחרה מ- טאק תגובת השיבוט שוכפלה לתוך צלחת באר עמוקה של 96 בארות עם מדיה של 800 מ"ל לבאר וגדלה בן לילה עם ניעור ב-300 סל"ד. תאים חולקו, וה-DNA הוכן באמצעות ערכת Qiprep 96 Turbo Miniprep (Qiagen). ה-DNA שנפלט הוגש ישירות לרצף.

ניגוד עניינים

המחברים מצהירים כי אין ניגוד עניינים בנוגע לפרסום מאמר זה.

תודות

עבודה זו הייתה חלק ממכון הביו-אנרגיה המשותף של DOE (http://www.jbei.org) שנתמך על ידי משרד האנרגיה האמריקאי, משרד המדע, המשרד למחקר ביולוגי וסביבתי, באמצעות חוזה DE-AC02-05CH11231 בין לורנס ברקלי המעבדה הלאומית ומשרד האנרגיה האמריקאי. המחברים רוצים להודות לדר. דומיניק אספוסיטו וג'ים הארטלי (NCI, פרדריק, MD) על המתנה של pDONR223 DNA, Huu M. Tran (JBEI/Sandia National Laboratories) על סיוע באוטומציה במעבדה, Drs. ריצ'רד שאן וסו ג'או (Quintara Biosciences, ברקלי, קליפורניה) לריצוף וניתוח DNA, וד"ר נתן ג'יי הילסון לקריאה ביקורתית של המאמר.

הפניות

  1. B. G. Fox, C. Goulding, M. G. Malkowski, L. Stewart, and A. Deacon, "גנומיקה מבנית: מגנים למבנים עם חומרים יקרי ערך ושאלות רבות ביניהם." שיטות טבע, כרך . 5, לא. 2, עמ' 129–132, 2008. צפה ב: אתר הוצאה לאור | Google Scholar
  2. A. Rolfs, W. R. Montor, S. Y. Sang וחב', "ייצור ואימות רצף של אוסף ORF מלא באורך מלא עבור החיידק הפתוגני Vibrio cholerae," הליכים של האקדמיה הלאומית למדעים של ארצות הברית של אמריקה, כרך . 105, לא. 11, עמ' 4364–4369, 2008. צפה ב: אתר מוציא לאור | Google Scholar
  3. G. Temple, P. Lamesch, S. Milstein וחב', "מהגנום לפרוטאום: פיתוח משאבי שיבוט ביטוי עבור הגנום האנושי." גנטיקה מולקולרית אנושית, כרך . 15, לא. 1, עמ' R31–R43, 2006. צפה ב: אתר מוציא לאור | Google Scholar
  4. J. Cline, J. C. Braman ו-H. H. Hogrefe, "נאמנות PCR של Pfu DNA פולימראז ופולימראזות DNA תרמוזיות אחרות," מחקר חומצות גרעין, כרך . 24, לא. 18, עמ' 3546–3551, 1996. צפה ב: אתר מוציא לאור | Google Scholar
  5. A.M. Dunning, P. Talmud, and S.E. Humphries, "שגיאות בתגובת שרשרת הפולימראז", מחקר חומצות גרעין, כרך . 16, לא. 21, עמ'. 10393, 1988. הצג ב: אתר מוציא לאור | Google Scholar
  6. R.K. Saiki, D.H. Gelfand, S. Stoffel וחב', "הגברה אנזימטית מכוונת פריימר של DNA עם פולימראז DNA תרמי יציב," מַדָע, כרך . 239, מס'. 4839, עמ' 487–491, 1988. לצפייה ב: אתר הוצאה לאור | Google Scholar
  7. K.R. Tindall ו-T.A. Kunkel, "נאמנות סינתזת ה-DNA על ידי פולימראז ה-DNA Thermus aquaticus," בִּיוֹכִימִיָה, כרך . 27, לא. 16, עמ' 6008–6013, 1988. לצפיה ב-: אתר הוצאה לאור | Google Scholar
  8. J.M. Flaman, T. Frebourg, V. Moreau et al., "A Fast PCR Fidelity Assay," מחקר חומצות גרעין, כרך . 22, לא. 15, עמ' 3259–3260, 1994. צפה ב: אתר מוציא לאור | Google Scholar
  9. P. Keohavong ו-W.G. Thilly, "נאמנות של פולימראזות DNA בהגברת DNA," הליכים של האקדמיה הלאומית למדעים של ארצות הברית של אמריקה, כרך . 86, לא. 23, עמ' 9253–9257, 1989. צפה ב: אתר מוציא לאור | Google Scholar
  10. P. André, A. Kim, K. Khrapko, ו-W.G. Thilly, "נאמנות וספקטרום מוטציה של Pfu DNA פולימראז על רצף DNA מיטוכונדריאלי אנושי," מחקר הגנום, כרך . 7, לא. 8, עמ' 843–852, 1997. צפה ב: Google Scholar
  11. G. S. Provost, P. L. Kretz, R. T. Hamner וחב', "מערכות טרנסגניות לניתוח מוטציות in vivo," מחקר מוטציות-מנגנונים יסודיים ומולקולריים של מוטגנזה, כרך . 288, מס'. 1, עמ' 133–149, 1993. צפה ב: אתר הוצאה לאור | Google Scholar
  12. T. A. Kunkel and K. Bebenek, "נאמנות שכפול DNA," סקירה שנתית של הביוכימיה, כרך . 69, עמ' 497–529, 2000. לצפייה ב: אתר מוציא לאור | Google Scholar
  13. M. Takagi, M. Nishioka, H. Kakihara וחב', "אפיון DNA פולימראז מ- Pyrococcus sp. זן KOD1 והיישום שלו ל-PCR," מיקרוביולוגיה יישומית וסביבתית, כרך . 63, לא. 11, עמ' 4504–4510, 1997. הצג ב: Google Scholar
  14. M. Kitabayashi, Y. Nishiya, M. Esaka, M. Itakura, ו-T. Imanaka, "שיבוט גנים ותגובת שרשרת פולימראז עם אנטיגן גרעיני של תאים מתרבים מ-Thermococcus kodakaraensis KOD1," ביו -מדע, ביוטכנולוגיה וביוכימיה, כרך . 66, לא. 10, עמ' 2194–2200, 2002. לצפייה ב: אתר מוציא לאור | Google Scholar
  15. K.S. Lundberg, D.D. Shoemaker, M.W.W. Adams, J.M. Short, J.A. Sorge, ו-E.J. Mathur, "הגברה בנאמנות גבוהה באמצעות פולימראז DNA יציב תרמי מבודד מ-Pyrococcus furiosus," גֵן, כרך . 108, לא. 1, עמ' 1–6, 1991. צפה ב: אתר המו"ל | Google Scholar
  16. M. Li, F. Diehl, D. Dressman, B. Vogelstein, and K. W. Kinzler, "BEAMing up for זיהוי וכימות של גרסאות רצף נדירות," שיטות טבע, כרך . 3, לא. 2, עמ' 95–97, 2006. צפה ב: אתר המו"ל | Google Scholar
  17. G. Marsischky ו-J. LaBaer, ​​"נתיבים רבים לשיבוטים רבים: מבט השוואתי על שיטות שיבוט בתפוקה גבוהה," מחקר הגנום, כרך . 14, לא. 10, עמ' 2020–2028, 2004. לצפייה ב: אתר מוציא לאור | Google Scholar
  18. J.T. Lis, "שבירה של שברי DNA על ידי משקעים המושרים על ידי פוליאתילן גליקול," שיטות באנזימולוגיה, כרך . 65, לא. 1, עמ' 347–353, 1980. צפה ב: אתר הוצאה לאור | Google Scholar
  19. J. J. Choi, J. Song, H. N. Ki וחב', "ספקטרום מצע ייחודי ויישום PCR של Nanoarchaeum equitans פולימראז DNA ממשפחת B", מיקרוביולוגיה יישומית וסביבתית, כרך . 74, לא. 21, עמ' 6563–6569, 2008. צפה ב: אתר מוציא לאור | Google Scholar
  20. L.L. Ling, P. Keohavong, C. Dias, ו-W.G. Thilly, "אופטימיזציה של תגובת שרשרת הפולימראז בהתייחס לנאמנות: T7, Taq ו-DNA פולימראזות משוונות", שיטות ויישומים של PCR, כרך . 1, לא. 1, עמ' 63–69, 1991. צפה ב: אתר המו"ל | Google Scholar
  21. K.A. Eckert ו-T.A. Kunkel, "סינתזת DNA בנאמנות גבוהה על ידי פולימראז ה-DNA Thermus aquaticus," מחקר חומצות גרעין, כרך . 18, לא. 13, עמ' 3739–3744, 1990. לצפייה ב: אתר הוצאה לאור | Google Scholar
  22. J.F. Davidson, R. Fox, D.D. Harris, S. Lyons-Abbott, and L.A. Loeb, "החדרה של תחום הקושר T3 DNA פולימראז thioredoxin משפרת את התהליכים והנאמנות של טאק DNA פולימראז", מחקר חומצות גרעין, כרך . 31, לא. 16, עמ' 4702–4709, 2003. לצפיה ב-: אתר הוצאה לאור | Google Scholar
  23. E. Viguera, D. Cancell, and S. D. Ehrlich, "החלקת שכפול כרוכה בהפסקה ופירוק של DNA פולימראז." כתב העת EMBO, כרך . 20, לא. 10, עמ' 2587–2595, 2001. צפה ב: אתר מוציא לאור | Google Scholar
  24. K. Khrapko, H. Coller, P. André וחב', "ספקטרומטריה מוטציונית ללא בחירה פנוטיפית: DNA מיטוכונדריאלי אנושי," מחקר חומצות גרעין, כרך . 25, לא. 4, עמ' 685–693, 1997. צפה ב: אתר הוצאה לאור | Google Scholar
  25. A. Niimi, S. Limsirichaikul, S. Yoshida וחב', "מוטציות דקלים בפולימראזות של DNA α ו η שנה את נאמנות שכפול הדנ"א ואת פעילות ההעברה", ביולוגיה מולקולרית ותאית, כרך . 24, לא. 7, עמ' 2734–2746, 2004. צפה ב: אתר מוציא לאור | Google Scholar
  26. E.M. Kennedy, C. Hergott, S. Dewhurst, ו-B. Kim, "הארכיטקטורה המכניסטית של מוטיב פולימראז A DNA של Pyrococcus furiosus תרמי יציב במשפחה B והאינטראקציה שלו עם מצע dNTP." בִּיוֹכִימִיָה, כרך . 48, לא. 47, עמ' 11161–11168, 2009. צפה ב: אתר מוציא לאור | Google Scholar
  27. T. A. Kunkel, S. S. Patel, ו-K. A. Johnson, "שכפול מועד לשגיאות של רצפי DNA חוזרים על ידי T7 DNA פולימראז בהעדר תת-יחידת התהליכים שלו." הליכים של האקדמיה הלאומית למדעים של ארצות הברית של אמריקה, כרך . 91, לא. 15, עמ' 6830–6834, 1994. לצפייה ב: אתר מוציא לאור | Google Scholar
  28. H. Huang ו-P. Keohavong, "נאמנות ומוטציות דומיננטיות המיוצרות על ידי פולימראזות DNA מסוג דיפ פורקן עמוק וחסרי אקסונוקלאז במהלך הגברה של DNA במבחנה." DNA וביולוגיה של התא, כרך . 15, לא. 7, עמ' 589–594, 1996. צפה ב: אתר הוצאה לאור | Google Scholar

זכויות יוצרים

זכויות יוצרים © 2014 Peter McInerney et al. זהו מאמר בגישה פתוחה המופץ תחת רישיון הייחוס של Creative Commons, המאפשר שימוש, הפצה ושכפול ללא הגבלה בכל מדיום, בתנאי שהיצירה המקורית מצוטטת כהלכה.


חומרים ושיטות

תגובה של מחזור שכפול (RCR)

חיץ של 5 × ריאקציית מחזור שכפול (RCR) (100 mM Tris-HCl pH8.0, 750 mM אשלגן גלוטמט, 50 mM אמוניום גופרתי, 50 mM Mg(OAc)2, 40 mM dithiothreitol (DTT), 20 mM קריאטין פוספט, 5 mM כל NTP, 0.5 mM כל dNTP, 0.25 mg/ml tRNA שמרים ו-1.25 mM NAD + ) ותערובת 4 × אנזים (2 mg/ml אלבום בסרום בקר , 0.08 מ"ג/מ"ל קריאטין קינאז, 0.1 מ"מ אדנוזין טריפוספט (ATP), 1.6 מיקרומטר SSB4, 160 ננומטר IHF2, 1.6 מיקרומטר DnaG, 160 ננומטר DnaN2, 20 nM Pol III*, 80 nM DnaB6ג6, 400 nM DnaA, 40 nM RNaseH, 200 nM ligase, 200 nM Pol I, 200 nM gyrase (GyrA2ב2), 20 ננומטר Topo IV (ParC2ה2), 200 ננומטר Topo III ו-200 ננומטר RecQ) הוכנו לתגובה הסטנדרטית, אלא אם צוין אחרת. תערובת התגובה (סופית 10 μl, אלא אם צוין אחרת) כללה חיץ של 5 × RCR (2 μl) ו-4 × תערובת אנזים (2.5 μl) והורכבה על קרח. לאחר הוספה של oriCהמכיל DNA מעגלי, התגובה הודגרה ב-30 מעלות צלזיוס לפרקים המצוינים. [α- 32 P]dATP נכלל ב-40-100 cpm/pmol של סך ה-deoxynucleotides כאשר מצוין. התגובה הופסקה על ידי הוספה של נפח שווה של 2 × מאגר Stop (50 מ"מ Tris-HCl pH8.0, 50 מ"מ חומצה אתילן-דיאמין-טטרה-אצטית, 0.2% נתרן דודציל סולפט, 0.1 מ"ג/מ"ל פרוטאינז K, 10% גליצרול ו-0.2% ברום-פנול כחול), והודגר עוד יותר ב-37 מעלות צלזיוס למשך 30 דקות ולאחר מכן מיצוי פנול-כלורופורם. מנה (2 μl) נותחה על ידי אלקטרופורזה של 0.5% אגרוז-ג'ל ואחריה צביעה של SYBR Green I (Molecular Probes) או על ידי הדמיית זרחן. התמונות נרכשו עם טייפון FLA 9500 (GE Healthcare). ניתן לאחסן את תערובת האנזים 4× ב-80 מעלות צלזיוס לאחר הקפאה מהירה בחנקן נוזלי ופעילותה נשמרת גם לאחר חמישה מחזורי הקפאה-הפשרה. טיהור חלבון מתואר בשיטות משלימות.

מדידה של [α-32 P]dATP-incorporation

מנה של מדגם RCR טופל בחומצה טריכלורואצטית 10%. שילוב נוקלאוטידים ב-DNA נמדד על ידי ספירת נוזלים של חומר בלתי מסיס בחומצה שנשמר על מסנני מיקרופייבר זכוכית Whatman GF/C.

כימות מספר מולקולות ה-DNA המעגליות על ידי טרנספורמציה ל אי - קולי

RCR בוצע עם oriC תבניות DNA עגולות המכילות קלטת עמידה לקנאמיצין. מנה (1 μl) של דגימת RCR עבר ישירות טרנספורמציה כימית לתוך אי - קולי זן DH5α. דגימת RCR דוללה במידת הצורך. מושבות עמידות Kanamycin (25 מיקרוגרם/מ"ל) גודלו ב-37 מעלות צלזיוס למשך הלילה על צלחות LB-agar ונספרו. כדי להסיק את מספר מולקולות ה-DNA המעגליות ממספר המושבה, 1 ng (10 8 מולקולות) של DNA מעגלי pOri8 שימש עבור כל ניסוי טרנספורמציה כסטנדרט כמותי, אשר נתן בדרך כלל ~10,000 מושבות.

מדידת קצב שגיאות השכפול

במשוואה זו, ו הוא חלק מהמושבות שהן כחולות ו M הוא מספר הכפלות האוכלוסייה. מספר האתרים הניתנים לזיהוי שגיאות (כלומר, אתרי יעד שאינם שקטים) ב-3 KB lacZ הגן הוערך ב-1000.

הרכבת DNA לשיבוט נטול תאים

תערובת 2 × שונה של Gibson Assembly (mGA) (200 mM Tris-HCl pH7.5, 20 mM MgCl2, 0.4 mM כל dNTP, 20 mM DTT, 10% PEG8000, 2 mM NAD + , 16 mU/μl T5 exonuclease, 50 mU/μl Phusion DNA polymerase) הוכן בבית, עם כמה שינויים כפי שתואר קודם (29). התגובה (נפח סופי 5 μl) כללה תערובת של 2 × mGA (2.5 μl) והכמויות המצוינות של שברי DNA, והורכבה על קרח והודגרה ב-50 מעלות צלזיוס למשך שעה אחת. שברי DNA הוגברו ב-PCR עם PrimeSTAR HS DNA פולימראז (Takara Bio) וטיהרו עם Wizard SV PCR Clean Up System (Promega). א 1 קילוב oriC הפרגמנט הוגבר עם פריימרים SUE654/SUE656 באמצעות ה- אי - קולי גנום K-12 MG1655 כתבנית. 3.3 קילובייט lacZ שבר כולל את lac האמרגן הוגבר עם פריימרים SUE594/SUE655 תוך שימוש בגנום MG1655 כתבנית. ה-4.6 קילובייט paraABC-Km הקסטה הוגברה עם פריימרים SUE635/SUE637 באמצעות pETcocoKm כתבנית. רצפי פריימר מפורטים בטבלה משלימה S1. מוצרי ההרכבה לפני או אחרי RCR נותחו בעקבות טרנספורמציה של אי - קולי זן NM554.

הכנת 'פופ-אאוט' של oriC-מכיל DNA מעגלי

pOri8 (9.5 kb), pOri80 (85 kb), pOri200 (205 kb), pMSR227 (205 kb) ו-pOriDif (12 kb) הוכנו בשיטת פופ-אאוט. λ רקומבינציה אדומה בוצעה ב אי - קולי זן K-12 MG1655 המכיל pKD46, כפי שתואר קודם (30), אלא ש-MH005, במקום MG1655, שימש עבור pMSR227. ה ק"מ קלטת (1.2 kb) הוגברה PCR מ-pUC4K עם פריימרים SUE351/SUE352 עבור pOri8. ה paraABC-Km קלטות (4.8 kb) הוגברו PCR מ-pETcocoKm עם פריימרים SUE409/SUE410 עבור pOri80 ו- SUE411/SUE412 עבור pOri200 ו-pMSR227. ה Km-oriC קלטת (2.1 kb) הוגברה PCR מ-pETcocoKmOri עם פריימרים SUE507/SUE509 עבור pOriDif. רצפי פריימר מפורטים בטבלה משלימה S1. קלטות אלה מכילות זרועות הומולוגיות של 40 bp המכוונות לאתרים 4 kb במעלה הזרם ומורד הזרם של הכרומוזומלי oriC אתר (עבור pOri8), 40 קילובייט במעלה ומורד הזרם של oriC (עבור pOri80), 100 קילובייט במעלה ומורד הזרם של oriC (עבור pOri200 ו-pMSR227) ו-4.2 ק"ב במעלה הזרם ו-6 ק"ב במורד הזרם של הכרומוזומלי הבדל אתר (עבור pOriDif). לאחר אלקטרופורציה, נבחרו מושבות עמידות לקנאמיצין והיווצרות מוצלחת של ה- oriCפלסמידים המכילים אומתו באמצעות PCR של מושבה. לאחר מכן טוהרו הפלסמידים באופן חלקי והשתמשו בהם לטרנספורמציה של אי - קולי זנים DH5α (עבור pOri8), HST08 (Takara Bio) (עבור pOri80, pOri200 ו- pMSR227) או DH10B (Life Technologies) (עבור pOriDif). טרנספורמנטים נבחרו לטיהור בקנה מידה גדול של הפלסמידים באמצעות ערכת הפלסמיד QIAfilter (Qiagen) (עבור pOri8 ו- pOriDif) או ערכת NucleoBond Xtra BAC (Takara Bio) (עבור pOri80, pOri200 ו- pMSR227). בזן MH005, נגזרת MG1655, ה dnaN הגן הוחלף ב-a mCherry-dnaN היתוך במיקום האנדוגני שלו.

מבני DNA אחרים

כדי לבנות את M13ms9 (8 kb), ה-0.42 kb oriC הפרגמנט הוגבר ב-PCR מהגנום MG1655 באמצעות פריימרים SUE260/SUE261, ואחריו עיכול NcoI-NsiI ושיבוט לוקטור שהוכן מ-M13mp18 על ידי PCR עם פריימרים SUE226/SUE227, ולאחר מכן עיכול NcoI-NsiI. כדי לבנות M13ms10 (8 kb), שבר של 0.25 kb המכיל את הכרומוזומלי terB אזור ושני הפוך terB הרצף הוגבר ב-PCR מהגנום MG1655 באמצעות פריימרים SUE236/SUE238, ואחריו עיכול NheI-NsiI ושיבוט לאתרי XbaI-PstI של M13ms9. צורות דופלקס, שכפול של פאג' הוכנו ב אי - קולי זן JM109 ומטוהר באמצעות ערכת הפלסמיד QIAfilter (Qiagen).

pPKOZ (8.9 kb) נבנה באמצעות שיטת השיבוט ללא תאים המתוארת באיור 6. לאחר טרנספורמציה של DH5α, הפלסמיד טוהר עם ערכת הפלסמיד QIAfilter. כדי לבנות pETcocoKm (11.3 kb), ה-1.2 bp ק"מ הפרגמנט הוגבר באמצעות PCR מ-pUC4k באמצעות פריימרים SUE296/SUE375, עוכל עם PciI-PstI, ושובט לתוך אתרי PciI-NsiI של pETcoco-2 (Novagen). כדי לבנות pETcocoKmOri, a 1 kb oriC הפרגמנט הוגבר ב-PCR מהגנום MG1655 באמצעות פריימרים SUE505/SUE506 ושובט לאתרי NheI-AatII של pETcocoKm. רצפי פריימר מפורטים בטבלה משלימה S1.


שיטת שיבוט PCR

שיבוט PCR שונה משיבוט מסורתי בכך שניתן להגביר את קטע ה-DNA המעניין, ואפילו את הווקטור, על ידי תגובת שרשרת ה- Polymerase Chain Reaction (PCR) ולקשר יחדיו, ללא שימוש באנזימי הגבלה. שיבוט PCR הוא שיטה מהירה לשיבוט גנים, והיא משמשת לעתים קרובות לפרויקטים הדורשים תפוקה גבוהה יותר ממה ששיטות שיבוט מסורתיות יכולות להכיל. היא מאפשרת שיבוט של שברי DNA שאינם זמינים בכמויות גדולות.

בדרך כלל, תגובת PCR מבוצעת כדי להגביר את רצף העניין, ולאחר מכן היא מחוברת לוקטור באמצעות קשירה קהה או בסיס יחיד לפני השינוי. שיבוט PCR מוקדם נעשה שימוש לעתים קרובות טאק DNA פולימראז להגברת הגן. כתוצאה מכך נוצר תוצר PCR עם תוספת בסיס בודדת בלתי תלויה בתבנית של שארית אדנין (A) לקצה ה-3' של תוצר ה-PCR, באמצעות הפעולה הרגילה של הפולימראז. מוצרים "A-tailed" אלה נקשרים לאחר מכן לוקטור T-tailed משלים באמצעות T4 DNA ligase, ולאחר מכן טרנספורמציה.

פולימראזות DNA בנאמנות גבוהה משמשים כעת באופן שגרתי להגברת רצפים עם מוצר PCR שאינו מכיל הרחבות 3'. קטעי הקצה הקהה מחוברים לוקטור פלסמיד באמצעות תגובת קשירה אופיינית או על ידי פעולת וקטור "מופעל" המכיל אנזים מחובר קוולנטי, בדרך כלל Topoisomerse I, המקל על החיבור של vector:insert. חלק ממערכות שיבוט PCR מכילות וקטורים מהונדסים של "התאבדות" הכוללים גן רעיל שאליו יש לקשור בהצלחה את תוצר ה-PCR כדי לאפשר התפשטות של הזן שקולט את המולקולה הרקומביננטית במהלך הטרנספורמציה.

חסרון טיפוסי המשותף לשיטות שיבוט PCR רבות הוא וקטור ייעודי שיש להשתמש בו. וקטורים אלה נמכרים בדרך כלל על ידי ספקים, כמו NEB, בפורמט ליניארי מוכן לשימוש ויכולים להוסיף הוצאה משמעותית לעלות הכוללת של שיבוט. כמו כן, השימוש בוקטורים ספציפיים מגביל את בחירתו של החוקר בעמידות לאנטיביוטיקה, זהות מקדם, שותפי היתוך ואלמנטים רגולטוריים אחרים.

  • יעילות גבוהה, עם וקטורים ייעודיים
  • נגיש לתפוקה גבוהה
  • אפשרויות וקטור מוגבלות
  • עלות גבוהה יותר
  • חוסר בקרת רצף בצומת
  • שיבוט מרובה מקטעים אינו ישר קדימה
  • שיבוט כיווני קשה

שיבוט PCR

שימו לב שהזמנים מבוססים על הערכות להעברת גן מפלסמיד אחד למשנהו. אם המקור להעברת גנים הוא gDNA, הוסף 2 שעות לחישוב עבור שיטת השיבוט המסורתית. הזמן הכולל אינו כולל טרנספורמציה, בידוד או ניתוח.

המדע שמאחורי הבדיקה לנגיף COVID-19

הבדיקה החדשה של Mayo Clinic לנגיף הגורם ל-COVID-19 מתוארת במהדורת חדשות לאחרונה כבדיקת PCR. למרות שרובם לא יודעים מה זה אומר, PCR הוא כלי בשימוש טוב במעבדה ובבדיקות רפואיות. לארי פיז, Ph.D., אימונולוג מאיו קליניק והפרופסור גורדון ה. וויולט ברטלס לביולוגיה תאית וקייל רודינו, Ph.D., מיקרוביולוג קליני, מסבירים כיצד בדיקה זו פועלת.

כדי להתחיל, PCR מייצג טכניקת מעבדה המכונה תגובת שרשרת פולימראז. בבדיקה זו, המטרה היא להגביר באופן סלקטיבי כמויות עקבות של חומר גנטי, ולזהות חלקים ספציפיים של DNA. רק כזכור, DNA הוא הקוד הגנטי הקיים בכל תא בגוף. כאשר תא מתחלק, הוא מעתיק DNA, מפריד בין שני הגדילים ואז יוצר גדיל DNA חדש על ידי העתקת התבנית. PCR מחקה את מה שקורה בדרך כלל בתאים.

Mayo Clinic הודיעה ב-12 במרץ 2020 כי פיתחה בדיקה שיכולה לזהות את נגיף SARS-CoV-2 בדגימות קליניות. וירוס SARS-CoV-2 גורם ל-COVID-19.

נעשה שימוש ב-DNA מכיוון שברמה המבחנה ביותר, מבנה ה-DNA יכול לומר לך באיזה אורגניזם מסתכלים. במקרה של בני אדם, PCR יכול לזהות אדם באמצעות החתימה הגנטית שלו. במקרה של COVID-19, חוקרים פרסמו יותר מ-100 גנומים שנאספו מחולים כדי לזהות תכונות מפתח של הנגיף שגורם למחלה זו, SARS-CoV-2.

PCR עובד רק על DNA, והנגיף COVID-19 משתמש ב-RNA כקוד הגנטי שלו. RNA דומה ל-DNA, אך יש לו רק גדיל בודד. למרבה המזל, אנזימים ויראליים להמרת RNA ל-DNA התגלו לפני עשרות שנים, ונרתמו, יחד עם PCR, כדי למצוא חתימות ייחודיות גם ב-RNA. במקרה זה, PCR מכונה PCR שעתוק הפוך, או RT-PCR.

תחילה אדם עם תסמינים של COVID-19 מתקשר לספק שירותי הבריאות המקומי שלו ושואל כיצד להעריך. זכור: התקשר קודם. אל תלך למרפאה או לבית החולים שלך מבלי להתקשר כדי לברר את הדרך הבטוחה ביותר להיבדק. ברגע שהמטופל מגיע לאתר בדיקה בטוח, נלקחת דגימה על ידי צוות הבריאות. בדרך כלל זה אומר שספוגית צרה מונחת באף או בפה של אדם כדי לאסוף תאים מהחלק האחורי של הגרון.

"דגימת נשימה עליונה, במיוחד ספוגית אף, היא הדגימה הנפוצה ביותר שנאספה כדי לזהות באופן אמין את הנגיף", אומר ד"ר רודינו. "כמה דגימות נשימה תחתונות כמו ליחה קבילות גם בכמה הגדרות."

במעבדה, הדגימה מעובדת כך שה-RNA מבודד ונאסף. כל השאר מוסרים. ה-RNA מעורבב עם מרכיבים נוספים: אנזימים (DNA פולימראז וטרנסקריפטאז הפוך), אבני בניין DNA, קו-פקטורים, בדיקות ופריימרים המזהים ונקשרים ל-SARS-CoV-2.

לאחר מכן ה-RNA הנגיפי מומר לעותק DNA, והעותק הבודד הזה מומר למיליוני עותקים באמצעות PCR שניתן לזהות בקלות.

התהליך הוא כדלקמן: באמצעות חום ואנזימים, גדילי DNA ויראלי מומרים נאלצים להיפרד. פריימרים קצרים של DNA התואמים לגדיל המשלים של תבנית ה-DNA הנגיפית נדבקים זה לזה, ומתפקדים כאתר התחלה מלאכותי לסינתזת DNA.

אבני בניין כימיות של DNA מתווספות ומחוברות יחד, ומרחיבות את פריימר ה-DNA הסינטטי ליצירת עותק של תבנית ה-DNA הנגיפית. גם פריימר שני שנעשה בכיוון ההפוך במורד הפריימר הראשון קיים בתגובה. זה יוצר עותק המשלים לגדיל המסונתז הראשון.

לאחר סבב אחד של סינתזת DNA, תערובת התגובה מחוממת כדי להמיס את שני הגדילים זה מזה, ויוצרת שתי תבניות שניתן להגביר עוד יותר בסיבוב הבא. העותקים מצטברים, סיבוב אחר סיבוב, באופן אקספוננציאלי, כך שנוצרים מיליוני ומיליוני עותקים ללימוד באמצעות גישות קונבנציונליות.

מכיוון שהאנזימים והכימיקלים שנוספו לצינור התגובה עמידים יחסית לחום - "האנזימים הרגישים לחום מבודדים מחיידקים עמידים תרמית ממעיינות חמים", אומר ד"ר פיז - התגובה יכולה להתקדם בצורה אוטומטית של חימום, קירור וקירור. סינתזת DNA. זה לוקח רק שעות כדי להשלים את המבחן ולקבל את התוצאות.

אם DNA משלים SARS-CoV-2 קיים בדגימה, הפריימרים יכולים להעתיק את האזורים הממוקדים. כשהם מעתיקים את האזורים הללו, בדיקות הדבוקות לשברים החדשים הללו משחררות אות חזותי שניתן לקרוא על ידי המכשיר המשמש בתהליך זה.

"מיליוני העותקים מגבירים את האות הזה כך שניתן לזהות אותו בקלות כתוצאה חיובית. אם הנגיף אינו קיים, הבדיקות לא נדבקות, אין שחרור אות וזו תוצאה שלילית", מסביר ד"ר רודינו.

סוג זה של ניתוח משמש למחקר ובדיקות מעבדה קליניות. PCR יכול לזהות את כל סוגי החיידקים, הטפילים, הווירוסים והפטריות, החל מ-DNA או RNA. בעוד שהעיקרון והמרכיבים דומים, כל שימוש דורש פריימרים או בדיקות ספציפיות כדי לזהות אורגניזמים שונים. לכן היה צריך לפתח משהו עבור SARS-CoV-2 מאפס. במהלך הפיתוח, סוגים אלה של בדיקות מותאמים כדי לוודא שהם טובים מאוד בזיהוי האורגניזם המעניין (רגיש) ולוודא שהבדיקה לא מציגה תוצאה חיובית כאשר האורגניזם אינו שם (ספציפי).

"חשיבותם של הצעדים הכרוכים ב-PCR הוכרה על ידי סדרה של פרסי נובל במשך עשרות שנים", אומר ד"ר פיז. "מדע הרפואה מתקדם כתוצאה מגילויים בסיסיים על הבסיס המולקולרי של מערכות חיות, וזו דוגמה אחת לאופן שבו התגליות הללו מתחברות יחד כדי לפתור בעיה חשובה בחיינו".

בעבודה כצוות מחקר וקליני, מומחי Mayo הצליחו להפעיל בדיקת PCR ל-SARS-CoV-2 תוך מספר שבועות - תוך גילוח של מה שבדרך כלל לוקח חודשים עד שנים.


צפו בסרטון: הרב מרדכי נויגרשל - חיסוני הקורונה - להתחסן או לא להתחסן - אנשי האני המחליט ודעת חכמים (אוֹקְטוֹבֶּר 2022).