מֵידָע

כאשר מודדים את אורך הטלומרים, האם השיטה מבוצעת על אוסף תאים מניבה ממוצע?

כאשר מודדים את אורך הטלומרים, האם השיטה מבוצעת על אוסף תאים מניבה ממוצע?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

מהן השיטות המשמשות למדידת טלומרים בבני אדם או בעלי חיים?

האם ניתן לעשות זאת על תא בודד?

האם החשש הבא הועלה וטופלו בעבר:

מה אם קיימת שונות טבעית באורך הטלומרים על בסיס תא לתא וקיימות שיטות שונות (פעילות גופנית מאומצת וכו') שמפעילות לחץ בחירה על אורך הטלומרים, אז אם שיטת המדידה מערבת בצורה כלשהי מספר תאים יש לך את ההשפעה של האורך הממוצע גדל בעוד משהו אחר התרחש בפועל. וכתוצאה מכך כל המחקרים הללו הגיעו למסקנה שאורך הטלומרים גדל.


ניתן למדוד טלומר באמצעות בדיקת דג זרימה. ביסודו של דבר סמנים פלואורסצנטיים הקושרים DNA מוכנסים לגרעין התא, ואז ניתן לספור את הסמנים הללו באמצעות שיטה שקוראת לזרימה ציטומטריית.

זה יכול להיעשות על תא אחד

אני לא בטוח שאני מבין את החלק האחרון של השאלה, אבל אני יכול לומר שאם גודל הטלמור הממוצע יגדל בגודל מדגם מסוים, אז המדענים לא יסיקו שום דבר על סמך הנתונים האלה.

אם יש מסקנה מדעית על גודל הטלומרים ביחס ללחצים סלקטיביים חיצוניים, יהיו נתונים מובהקים סטטיסטית שמסבירים כראוי את השונות שנצפו בתאים שונים.


שיטת PCR כמותית למדידת אורך טלומרים מוחלט

אנו מתארים שיטה פשוטה וניתנת לשחזור למדידת אורך טלומרים מוחלט (aTL) באמצעות תגובת שרשרת פולימראז כמותית בזמן אמת (qPCR). שיטה זו מבוססת על שיטת Cawthon למדידה יחסית של אורך הטלומרים (TL) אך שונה על ידי הצגת תקן אוליגומר למדידת aTL. השיטה מתארת ​​את תקני האוליגומר, יצירת עקומת התקן והחישובים הנדרשים לחישוב aTL מנתוני qPCR. הבקרות ומאפייני הביצועים הדרושים של המבחן מתוארים בפירוט ומשווים ביחס לשיטות אחרות למדידת TL. תוצאות אופייניות למבחן זה עבור מגוון דגימות רקמות אנושיות מסופקות, כמו גם לוח זמנים לפתרון בעיות. שיטה זו מאפשרת מדידת תפוקה גבוהה של aTL תוך שימוש בכמויות קטנות של DNA מה שהופך אותה מתאימה למחקרים אפידמיולוגיים מולקולריים. בהשוואה למבחני TL qPCR יחסית מסורתיים, שיטת aTL המתוארת בפרוטוקול זה מאפשרת השוואה ישירה יותר של תוצאות בין ניסויים בתוך ובין מעבדות.


רקע כללי

הדעה הרווחת היא שלנקבות יש טלומרים ארוכים יותר מאשר לזכרים, אם כי תוצאות מחקרים היו סותרות.

שיטות

ביצענו סקירה שיטתית ומטה-אנליזות כדי לבדוק את ההשערה שאצל בני אדם, לנקבות יש טלומרים ארוכים יותר מאשר לזכרים ושהקשר הזה מתחזק עם העלייה בגיל. חיפושים נערכו ב-EMBASE וב- MEDLINE (עד נובמבר 2009) ומערכי נתונים נוספים התקבלו מחוקרי המחקר. מחקרים תצפיתיים מתאימים מדדו טלומרים הן עבור נקבות והן עבור זכרים בכל גיל, היו בגודל מדגם מינימלי של 100 וכללו משתתפים שאינם חלק מקבוצה חולה. חישבנו אומדני סיכום באמצעות מטא-אנליזות של אפקטים אקראיים. ההטרוגניות בין המחקרים נחקרה באמצעות ניתוח תת-קבוצות ומטה-רגרסיה.

תוצאות

מטא-אנליזות מ-36 קבוצות (36,230 משתתפים) הראו שבממוצע לנשים יש טלומרים ארוכים יותר מגברים (הבדל מתוקנן באורך הטלומרים בין נקבות לזכרים 0.090, CI 95% 0.015, 0.166 מותאם גיל). היו מעט עדויות לכך שהקשרים הללו משתנים לפי קבוצת גיל (p=1.00) או סוג תא (p=0.29). עם זאת, גודלו של הבדל זה השתנה לפי שיטות המדידה, כאשר רק Southern blot אך לא PCR בזמן אמת ולא Flow-FISH הראו הבדל משמעותי. הבדל זה לא היה קשור לשגיאת מדידה אקראית.

מסקנות

אורך הטלומרים ארוך יותר אצל נקבות מזכרים, אם כי הבדל זה לא נמצא באופן אוניברסלי במחקרים שלא השתמשו בשיטות הכתם הדרומי. נדרש מחקר נוסף על הסברים להבדלים המתודולוגיים.


טלומרים בלחץ

הטלומרים מגנים על שלמות הכרומוזומים. הם מתקצרים עם כל חלוקת תאים ברוב התאים מאחר והטלומראז אינו פעיל ברוב המוחלט של תאי האדם [10]. אפשר לומר שהם "מקריבים" את עצמם. במיוחד מאחר שאיבוד רצף טלומר אינו קריטי למצב המטבולי הנוכחי של תא כמו איבוד רצף ה-DNA המקודד לחלבון. תפקידים אחרים של הטלומרים כוללים מניעת הצטרפות או היווצרות של כרומוזומים מזוהה כשברי גדילים כפולים ב-DNA, שבתורם, יתריעו על מנגנוני תיקון DNA [11]. עם זאת, עם הזמן, אורך הטלומרים בתאים נורמליים פוחת עד שהם הופכים קצרים מכדי למלא את תפקידם ולהשאיר את התאים מסוגלים להתחלק. גורם להזדקנות תאית שהיא אחת הסיבות העיקריות להזדקנות ולהפרעות הקשורות להזדקנות [12] הקשורות לבעיית השכפול הקצה (מגבלת הייפליק) [13].

ביטוי ופעילות טלומראז בתאים אנושיים יורדים עם הגיל [14]. עם זאת, מדובר בתופעה אינדיבידואלית ושיעור השחיקה של הטלומרים קשור, בין היתר, ליכולת לכבוש מתח. כפי שהוצע, פעילות גופנית (הנתפשת כאחת הדרכים העיקריות להפחתת רמת הלחץ) קשורה להזדקנות בריאה ולהפחתת הסיכון למספר הפרעות כרוניות, אולי עקב שיקום הטלומרים [15, 16]. ברמה התאית, מתח מתייחס לגורמים שיכולים להשפיע על חילוף החומרים או לפגוע בתא. עם זאת, ללא קשר לרמה, מתח מצטבר בהדרגה יחד עם ההזדקנות, והוא עלול להשפיע לרעה על בריאותו ורווחתו של הפרט. חשוב לציין כי נוגדי חמצון הוכחו לעכב את תחילת הזדקנות כלי הדם באופן תלוי טלומראז. במחקר חוץ-גופני, הוכח כי מיני החמצן התגובתי (ROS) מפחיתים את רמת חלבון hTERT (human telomerase reverse transcriptase) גרעיני (תת-היחידה המרכזית של טלומראז) ופעילות טלומראז בתאי האנדותל, ואחריה התפתחות פנוטיפ מזדקן. . במקביל, דגירה עם נוגד החמצון N-אצטילציסטאין חסמה את הייצוא הגרעיני הזה של hTERT לתוך הציטוזול, מה שמרמז על תפקידו בתגובת לחץ [17]. נוגד חמצון ידוע נוסף - א-טוקופרול, הוכח כמדחיק את קיצור הטלומרים ושומר על פעילות הטלומראז באנדותליוציטים מיקרו-וסקולריים במוח [18]. באופן דומה, תמצית Ginko Biloba (בעלת פוטנציאל נוגד חמצון גבוה) הוכחה כמעכבת את תחילת ההזדקנות באמצעות הפעלת טלומראז דרך מסלול איתות PI3k/Akt [19, 20]. חשוב לציין, מתח כרוני מביא להפרשה מוגברת של קורטיזול המסוגל לדכא את הפעלת הטלומראז במערכת החיסון, וכתוצאה מכך, לקדם שחיקה של הטלומרים [21].

העובדה היא שההזדקנות מלווה בשחיקה של טלומרים, למרות שקצבה הטרוגני מאוד בין פרטים, סוגים שונים של תאים אך גם כרומוזומים שונים [22]. במיוחד ההיבט האחרון מוביל למסקנה שתאים יכולים לעבור הזדקנות בטרם עת, גם כאשר אורך הטלומרים הממוצע הוא "נורמלי", אבל כמה קצוות כרומוזומים ספציפיים קצרים באופן קריטי. מכיוון שיש כמה מסלולים ביוכימיים משותפים להזדקנות, תגובת לחץ ושחיקה של טלומרים, אנו מאמינים כי קצוות הכרומוזומים הם סמני מתח רגישים מאוד ואינדיקטורים אמינים להזדקנות תאית. עם זאת, נראה שהדרך היחידה להכיר באורך הטלומרים כסמן הזדקנות/הזדקנות/חשיפה למתח היא להעריך את האורך/שיעור השחיקה של כרומוזומים בודדים בודדים ולא למדוד את אורך הטלומרים הכולל בממוצע.

דו"ח מכריע נוסף הודגם על ידי Garrett-Bakelman וחב', שהדגימו מחקר הקשור לחשיפה לירידה בכוח הכבידה. כפי שמוצג, אסטרונאוט (סקוט קלי), ששהה כמעט שנה בתחנת החלל הבינלאומית, חווה כמה תסמונות קשות (הפחתת מסת הגוף, חוסר יציבות בגנום שלו, נפיחות בכלי הדם העיקריים, שינויים בצורת העיניים, שינויים בחילוף החומרים, דלקת ושינויים במיקרוביום שלו) אך גם התארכות משמעותית של הטלומרים. חשוב לציין, קצוות הכרומוזום התקצרו שוב לאחר שהאסטרונאוט נחת וחזר לרמות כמעט לפני הטיסה תוך 6 חודשים לאחר החזרה לכדור הארץ. עם זאת, המספר המוגבר של הטלומרים הקצרים נצפה, והביטוי של כמה גנים עדיין היה מופרע. במקביל, אחיו התאום הזהה (לא בילה את הזמן בחלל) נוטר כנקודת התייחסות שלא הראתה שינויים משמעותיים באורך הטלומרים [23]. מקרה זה מראה עד כמה מורכבת ויסות הטלומרים.


שיטות

נושאים ובקרות

מחקר בריאות הריאות (LHS). המחקר השתמש בנתונים קליניים ובחומרים ביולוגיים שהושגו במחקר בריאות הריאות (LHS), ניסוי קליני בחסות המכון הלאומי ללב, ריאות ודם. לאחר קבלת הסכמה מדעת בכתב, ה-LHS רשם תחילה 5887 מעשנים, בני 35� שנים עם הגבלת זרימת אוויר קלה עד בינונית (מוגדר כיחס של נפח נשיפה מאולץ בשנייה אחת (FEV1) ליכולת חיונית מאולצת (FVC)𢙀.70 ו-55㳾V1㲐% חזוי) על פני 10 מרכזים בצפון אמריקה [15]. אנשים עם היסטוריה של סרטן (למעט קרצינומה באתרית או קרצינומה של תאי בסיס של העור), אוטם שריר הלב (בשנתיים האחרונות), אנגינה, אי ספיקת לב, שבץ מוחי (בשנתיים האחרונות), אי ספיקת כליות, אינסולין- הדורשים סוכרת, שחמת או מחלות כבד חמורות אחרות, תסחיף ריאתי, הפרעות במערכת העצבים המרכזית, גלאוקומה צרת זווית או כל מחלה מרכזית אחרת שעלולה הייתה לסכן את המעקב לא נכללו [16].

במהלך 5 שנות המעקב הראשונות, תפקודי הריאות ומצב העישון של המשתתפים הוערכו מדי שנה. המשתתפים סווגו כגמלים מתמשכים אם היו מאומתים שאינם מעשנים בכל ביקור שנתי. משתתפים שהיו מעשנים בכל ביקור שנתי היו מעשנים ממשיכים. אלה שהתנהגות העישון שלהם הייתה שונה סווגו כגמלים לסירוגין. בשנה 5, 4,803 משתתפים סיפקו דגימות דם (המייצגות 89% מהמשתתפים המתאימים). דגימות הדם הופרדו לחלקים המרכיבים שלהן ואוחסנו במקפיאים �ଌ עד לשימוש. לאחר מכן עקבו אחר משתתפי המחקר באופן פסיבי עד סוף שנת 2001 למשך מעקב חציוני של 7.5 שנים ממועד ניקור הורידים ועד לסגירת המחקר. במהלך המעקב תועד מצבם החיוני והאשפוזים של המשתתפים. ועדת תמותה ותחלואה בחנה את כל רישומי החולים, לרבות תעודות פטירה, דיווחי עדי ראייה, רישומי נתיחה, סיכומי ראיונות עם רופאים מטפלים ורישומי אשפוז וקבעה סיבה לתמותה לכל המוות. נתונים אלו נוספו על ידי מדד מוות לאומי שסיפק את תאריך וסיבת המוות לכל משתתפי המחקר האמריקאי [16]. נקודות הסיום של התמותה קובצו לפי: מחלת לב כלילית, מחלות לב וכלי דם (שכוללות גם מחלת לב כלילית), סרטן ריאות, כל סוגי הסרטן (שכללו סרטן ריאות), מחלות דרכי הנשימה למעט סרטן ריאות, אחרים ולא ידועים.

קבוצת מחקר של הזדקנות בריאה. כדי להשוות את אורכי הטלומרים של נבדקי COPD ב-LHS לקבוצת ביקורת ללא COPD, השתמשנו בנתוני טלומרים של נבדקים בגיל העמידה ממחקר ההזדקנות הבריאה, שהיו בין 40 ל-50 שנים וגויסו באופן אקראי ללא קשר לבריאות או מצב מחלה (כלומר בקרות שליליות) [17].

Advair, Biomarkers בקבוצת COPD (ABC). כקבוצת ביקורת שנייה (כלומר בקרות “positive”), מדדנו את אורך הטלומרים של לויקוציטים היקפיים שהתקבלו מחולים עם COPD בינוני עד חמור, כפי שהוגדר ספירומטרית על ידי FEV1יחס /FVC פחות מ-70% ו-FEV1 פחות מ-80% מהחזויים, שהיו בעלי היסטוריה של עישון של לפחות 10 שנות עישון והיו לפחות בני 40 [18]. תוצאות מחקר זה פורסמו בעבר [13].

מיצוי DNA של לויקוציטים

ריכוז ה-DNA מדם היקפי שנאסף בשנה 5 נקבע באמצעות ספקטרופוטומטר NanoDrop 8000 (Thermo Scientific, Wilmington, ארה"ב). דגימות ה-DNA דוללו ל-1 ng/µL במאגר 1× Tris-EDTA ואוחסנו ב-�ଌ לשימוש לאחר מכן בתגובת שרשרת פולימראז כמותית (qPCR).

מדידת אורך טלומר

טלומרים לויקוציטים בדם היקפי נמדדו באמצעות פרוטוקול qPCR שונה שתואר על ידי Cawthon [19]. רצפי ההתחלה (כתוב 5′𡤣′) היו: טל 1, GGTTTTTGAG -GGTGAGGGTGAGGGTGAGGGTGAGGGT טל 2, TCCCGACTATCCCTATCCCTATCCC -TATCCCTATCCCTA 36B4u, CAGCAAGTGGGAAGGTGTAATCC 36B4d, CCCATTCTA -TCATCAACGGGTACAA. גן ההתייחסות לעותק בודד שנעשה בו שימוש היה 36B4 והריכוזים הסופיים של הפריימרים (Sigma, The Woodlands, TX) היו tel 1, 270 nM tel 2, 900 nM, 36B4u, 300 nM 36B4d, 500 nM.

מדידת אורך הטלומרים בוצעה בשלושה עותקים עבור כל הדגימות בצלחת תגובה אופטית ברורה בעלת 384 בארות (Applied Biosystems, Foster City, CA). DNA התייחסות שהתקבל ממכון Coriell (קמדן, ניו ג'רזי) נבדק בשלושה עותקים בכל צלחת PCR כדי לקחת בחשבון את וריאציות המדידה בין-צלחות. כל באר הכילה 10 µL QuantiTect SYBR Green PCR Master Mix (QIAGEN, Mississauga, ON) וריכוז DNA סופי של 0.25 ng/µL. לאחר הטעינה, הצלחות נאטמו עם סרט דבק אופטי MicroAmp (Applied Biosystems, Foster City, CA) ועברו צנטריפוגה קצרה ב-2,500 סל"ד. התגובות בוצעו במערכת ABI PRISM 7900HT זיהוי רצף (Applied Biosystems, Foster City CA). פרופיל המחזוריות התרמית עבור הגברת גנים של טלומרים והן בעותק בודד התחיל ב-50ଌ למשך 2 דקות ואז 95ଌ למשך 2 דקות. עבור ה-Telomere PCR, בוצעו 30 מחזורים של 95ଌ למשך 15 שניות ו-54ଌ למשך 2 דקות. אחרי פרופיל הרכיבה 36B4 הגיעו 35 מחזורים של 95ଌ למשך 15 שניות ו-58ଌ למשך דקה אחת. אורך הטלומרים כמת כיחס T/S (T = telomere, S = single copy gene), שחושב לפי הנוסחה של Cawthon [19].

ניתוח סטטיסטי

אורכי הטלומרים של לויקוציטים בדם היקפי תוקנה לגן הייחוס של עותק בודד (T/S). למטרות אנליטיות, המשתתפים חולקו לרבעונים על סמך יחס ה-T/S שלהם. לאחר מכן הושוו המאפיינים הקליניים באמצעות מבחן כי-ריבוע למשתנים דיכוטומיים (באמצעות דרגות חופש מתאימות) ומבחן Cochran-Armitage למגמה למשתנים מתמשכים. נקודת הסיום העיקרית למחקר זה הייתה תמותה מכל הסיבות. השווינו את הסיכון לתמותה מכל הסיבות על פני הרביעונים לאורך תקופת המעקב באמצעות שיטת קפלן-מאייר (K-M) לניתוח החד-משתני ומודל סיכונים פרופורציונליים של Cox עבור הניתוח הרב-משתני. עקומות ההישרדות של K-M על פני רבעוני ה-T/S הושוו באמצעות מבחן לוג-rank. במודל הרב-משתני, כללנו את המשתנים הבאים: גיל, מגדר, מדד מסת הגוף (BMI), מצב עישון ב-5 השנים הראשונות של המעקב, שנות עישון, לחץ דם בשנה 5 ו-FEV1 בשנה 5. FEV1, BMI, מדידות לחץ דם ושנות אריזה של עישון לא השפיעו באופן משמעותי על תוצאות המודל. לפיכך, הם הושמטו בסופו של דבר. גישה דומה שימשה עבור נקודות קצה לתמותה ספציפיות לסיבה. יחסי T/S בין קבוצות העישון הושוו באמצעות מבחן Kruskal-Wallis, מכיוון שהנתונים היו לא תקינים. מתאמים בין יחס T/S למשתנים כגון FEV1 בגיל 5 וגיל נבדקו באמצעות מבחן Spearman עבור משתנים לא פרמטריים. ערכי P הנמוכים מ-0.05 (באמצעות מבחן דו-זנבתי) נחשבו מובהקים. כל הניתוחים נערכו באמצעות SAS (גרסה 9.1, Carey, N.C.). השימוש בדגימות מחקרי LHS ו-ABC אושר על ידי מועצת האתיקה למחקר של Providence Health Care/UBC. השימוש בדגימות ממחקר הזדקנות בריאה אושר על ידי מועצת האתיקה של המחקר הקליני של UBC והסוכנות הבריטית לסרטן בקולומביה.


תוצאות

נתונים סטטיסטיים תיאוריים והבדלי קבוצות על פני משתני המחקר מוצגים בטבלה 1. מתאמים דו משתנים מוצגים בטבלה 2. כפי שמוצג בטבלאות אלו, היו הבדלים קבוצתיים במשקל לידה ובמנת משכל. כמו כן, משקל לידה, מנת משכל ומין היו קשורים באופן משתנה לפסיכופתולוגיה. לפיכך, הרצנו מחדש מודלים נפרדים של נתיב עם כל אחד ממין, מנת משכל ומשקל לידה כמשתנים, והתוצאות לא היו שונות מהותית. כפי שניתן לראות בטבלה 1, לא היו קשרים ישירים בין אורך הטלומרים בכל נקודת זמן ובין מצב הקבוצה – או בהשוואה של NIG ל-EIG, או FCG ל-CAUG. כפי שניתן לראות בטבלה 2, הייתה יציבות מסדר דרגה ב-TL לאורך זמן, כלומר אנשים עם טלומרים קצרים יותר בגיל 8� נטו לסבול לטלומרים קצרים יותר בגיל 12� בהשוואה לאלו עם טלומרים ארוכים יותר. יתרה מכך, בהתאם למחקרים קודמים, היה קיצור טלומרים לאורך זמן על פני כל המדגם, ט (df ​​= 76) = 3.01, ע' = .004.

שולחן 1:

מאפיינים וסטטיסטיקה תיאורית בקרב ילדים ממוסדים ומעולם לא ממוסדים

גיל 8� מידות
כל המשתתפיםילדים ממוסדים בלבד
EIG (נ= 96)NIG (נ= 99)ט אוֹ χ 2 CAUG (נ= 44)FCG (נ= 52)ט אוֹ χ 2
מין (% זכר)52.1%48.5%.2552.351.9.001
משקל לידה (ג)2755.23208.05.06 *** 2847.52675.01.33
IQ בקנה מידה מלא80.2100.29.30 *** 78.281.91.29
גורם כללי.45−.446.84 *** .51.40.57
גורם הפנמה.04−.04.63.12−.02.69
גורם חיצוני.00.00.06.06−.04.44
אורך טלומר1.601.59.061.531.65.74
גיל 12� מידות
כל המשתתפיםילדים ממוסדים בלבד
EIG (נ= 112)NIG (נ= 50)ט אוֹ χ 2 CAUG (נ= 56)FCG (נ= 56)ט אוֹ χ 2
מין (% זכר)51.846.0.4651.851.8<.001
משקל לידה (ג)2799.53244.94.29 *** 2878.62722.01.31
IQ בקנה מידה מלא72.398.19.00 *** 68.675.82.19 *
גורם כללי.20−.444.29 *** .34.061.52
גורם הפנמה−.05.111.22−.01−.09.58
גורם חיצוני.16−.374.44 *** .23.10.63
אורך טלומר1.401.43.641.381.41.59

הערה: כל הנתונים הסטטיסטיים הם אמצעים למעט מין (%). משתנים כלליים, מפנים ומחצינים הם ציוני גורמים עם ממוצע מדגם כולל של אפס.

מנת משכל הוערכה באמצעות WISC-IV. משקל לידה נמדד בגרמים. ציוני אורך הטלומרים אינם מותאמים בטבלה זו.

שולחן 2:

מתאמים דו משתנים בין משתני מחקר ומאפיינים אחרים של ילדים

1.2.3.4.5.6.7.8.9.10.11.
1. גורם כללי (גיל 8�)
2. גורם הפנמה (גיל 8�).00
3. גורם חיצוני (גיל 8�).00.02
4. אורך הטלומרים (גיל 8�)−.02−.19 § .03
5. גורם כללי (גיל 12�).29 ** .00−.09.18
6. גורם הפנמה (גיל 12�)−.23 ** .12.04.03.15 §
7. גורם חיצוני (גיל 12�).37 *** −.04.06−.02.04−.25 **
8. אורך הטלומרים (גיל 12�)−.05−.25 ** .08.35 ** −.22 ** −.05−.01
9. מין (זכר).15 * −.07−.05.01.16 * .01.24 ** −.01
10. משקל לידה−.23 ** −.09.23 ** .01−.22 ** −.13−.11−.16 § .09
11. FSIQ (גיל 8�)−.54 *** −.10.05.04−.08.34 ***
12. FSIQ (גיל 12�)−.31 *** .12−.32 *** .02−.08.29 ** .90 ***

בהתחשב בממצאים קודמים של קשרים ספציפיים למין בין משך הטיפול המוסדי ואורך הטלומרים, אנו מציגים מתאמים בין משך הזמן השהייה במוסדות בקרב EIG (אחוז מחייו של אדם עד גיל נתון) לבין אורך הטלומרים עבור זכר ונקבה משתתפים בטבלה S1, זמינה באינטרנט. משך זמן רב יותר של טיפול מוסדי בגיל 54 חודשים ו-8 שנים היה קשור באורך טלומרים קצר יותר בגיל 8� במשתתפים גברים. בנשים משתתפות, משך טיפול מוסדי ארוך יותר בתחילת המחקר ו-54 חודשים היה קשור באורך טלומרים קצר יותר בגיל 12�. כמות הזמן שהושקעה במוסדות לאורך זמן הייתה בקורלציה (טבלה S2, זמינה באינטרנט). כאשר משך הטיפול המוסדי ואורך הטלומרים נבדקו במסגרת FCG ו-CAUG (החשבון על מין), חשיפה גדולה יותר לטיפול מוסדי לאחר 54 חודשים, 8 שנים ו-12 שנים הייתה קשורה לאורך טלומרים קצר יותר בגיל 12� בקרב CAUG, אך לא FCG (טבלה S3, זמינה באינטרנט). הבדלי מין לא נבדקו בקבוצות FCG ו-CAUG עקב מגבלות כוח. אנו מרחיבים את הממצאים הללו במוסף 1. לפיכך, ישנם קשרים בין משך המיסוד ואורך הטלומרים המשתנים בהתאם למין ולגיל ההערכה ולא קשרים ישירים בין קבוצת המיסוד ואורך הטלומרים. הקשר החזק בין מצב מיסוד (NIG = 0 EIG = 1) לבין פסיכופתולוגיה מצדיק את הכללתו כמשתנה במודל הראשוני, המתואר להלן.

קשר בין אורך הטלומרים לפסיכופתולוגיה

מודל הנתיב האורך המתאר את הקשר בין אורך הטלומרים לבין הגורמים הכלליים, ההפנמה והחצינה מוצג באיור 1. התאמת הדגם הייתה מקובלת: RMSEA = .069 [.02, .11], PCLOSE = .22, CFI = .90 ו-SRMR = .05. לילדים של EIG הייתה פסיכופתולוגיה כללית גבוהה משמעותית בגיל 8� מאשר NIG, אולם מצב המוסדות לא היה קשור להפנמה או החצנה בגיל 8� לאחר שהתייחסו לגורם הכללי. יתר על כן, הייתה יציבות יחסית בפסיכופתולוגיה כללית לאורך זמן, ללא קשר לסטטוס המוסדי, אך יציבות מועטה בהפנמה או החצנה לאחר התחשבות ביציבות בגורם הכללי.

הערה. הפרמטרים הם סטנדרטיים β מקדמים. גורמים פסיכופתולוגיים הם ציוני גורמים שנשמרו מהמודל הדו-פקטור הסמוי ומשמשים כמשתנים מניפסטים. מוצגים רק הקשרים בין אורך הטלומרים לפסיכופתולוגיה. ראה טבלה 1 לקשר בין ציוני גורמי פסיכופתולוגיה. EIG = קבוצת אי פעם ממוסדת NIG = לעולם לא ממוסדת.

במונחים של בתוך הזמן קשרים, אורך טלומרים קצר יותר בגיל 8� היה קשור באופן משמעותי לבעיות הפנמה גבוהות יותר, אך לא היה קשור לפסיכופתולוגיה כללית או מחצינה. מצד שני, אורך טלומרים קצר יותר בגיל 12� היה קשור לפסיכופתולוגיה כללית גבוהה יותר, אך לא הפנמה או החצנה. סוף כל סוף, מעבר לזמן השפעות (כלומר, אסוציאציות בפיגור צולבות) גילו שפסיכופתולוגיה של הפנמה גבוהה יותר בגיל 8, חזתה אורך טלומרים קצר יותר בגיל 12, לאחר שליטת אורך הטלומרים בגיל 8�. השפעה זו יכולה להתפרש כפסיכופתולוגיה הפנמה גבוהה יותר המנבאת שינוי באורך הטלומרים מגיל 8� עד גיל 12�. לא פסיכופתולוגיה כללית או מחצינה בגיל 8� הייתה קשורה לאורך הטלומרים בגיל 12�, ולא הופיעו השפעות הדדיות של אורך הטלומרים על הפסיכופתולוגיה. כל ההשפעות נבדקו בו-זמנית ומותנות בכל ההשפעות האחרות במודל. מכיוון שלא מדובר בבדיקות עצמאיות, לא נדרש תיקון לבדיקות מרובות.

לבסוף, בהתאם לכוונה המקורית של ה-RCT, בדקנו האם הקשר בין הגורמים הפסיכופתולוגיים ואורך הטלומרים שונה בין: (i) EIG ו-NIG, ו-(ii) CAUG ו-FCG. המודל האחרון הציע התאמה גרועה לנתונים, ככל הנראה בשל עוצמה לא מספקת בהתחשב בגודל המדגם הקטן של קבוצות CAUG ו-FCG. תוצאות של המודל הקודם מסופקות במוסף 1, זמין באינטרנט. מכיוון שלא היו הבדלים נצפים בנתיבים המקשרים בין פסיכופתולוגיה ואורך הטלומרים בין ילדי EIG ו-NIG, המודל העיקרי לעיל קרס על פני כל הילדים.


תודות

סקירה זו היא תוצאה של דיונים ושיתופי פעולה העולים מסדנה על דינמיקה של טלומרים באורגניזמים שאינם מודל. הסדנה נתמכה על ידי מענק סדנאות בינלאומיות של BBSRC ותמיכה נוספת מהאגודה הגנטית ו-Agilent Technologies, ומפרס לחוקר מתקדם של מועצת המחקר האירופית לראש הממשלה. אנו מודים לכל המשתתפים בסדנה על תרומתם לדיונים שלנו על שיטות מדידת טלומרים, ולאברהם אביב, חנה פרוי ופרנסואה קריסקוולו על הערותיהם על טיוטות כתבי יד. DHN נתמך על ידי מלגת BBSRC דיוויד פיליפס.

שם קובץ תיאור
mee312161-sup-0001-TableS1.docxWord מסמך, 16.1 KB טבלה S1. רשימה של מינים ורקמות אחסון ושיטות מיצוי DNA והתאמתן לניתוח אורך טלומרים לאחר מכן, בהתבסס על ניסיון העבר של המחברים ותקשורת אישית עם עמיתים. AE ו-TE מתייחסים לפתרונות חיץ נפוצים: AE היא תערובת של נתרן אצטט ו-EDTA, TE של תמיסת Tris ו-EDTA.

שימו לב: המוציא לאור אינו אחראי לתוכן או לפונקציונליות של כל מידע תומך שסופק על ידי המחברים. יש להפנות כל שאילתה (מלבד תוכן חסר) למחבר המתאים למאמר.


חומר משלים אלקטרוני זמין באינטרנט בכתובת https://doi.org/10.6084/m9.figshare.c.5001038.

פורסם על ידי החברה המלכותית על פי תנאי רישיון הייחוס של Creative Commons http://creativecommons.org/licenses/by/4.0/, המאפשר שימוש ללא הגבלה, בתנאי שהמחבר המקורי ומקורו יזכו.

הפניות

. 2006 האם דינמיקת הטלומרים מקשרת בין אורח חיים ותוחלת חיים? מגמות אקול. Evol. 21, 47-53. (doi:10.1016/j.tree.2005.11.007) Crossref, PubMed, ISI, Google Scholar

. 2010 טלומרים ותולדות חיים: הארוכים והקצרים שבהם. אן. NY Acad. Sci. 1206, 130-142. (doi:10.1111/j.1749-6632.2010.05705.x) Crossref, PubMed, ISI, Google Scholar

Haussmann MF, Marchetto NM

. 2010 טלומרים: קישור מתח והישרדות, אקולוגיה ואבולוציה. קור. זוול. 56, 714-727. (doi:10.1093/czooolo/56.6.714) Crossref, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CF

. 2018 אקולוגיה אבולוציונית של טלומרים: סקירה. אן. NY Acad. Sci. 1422, 5-28. (doi: 10.1111/nyas.13443) Crossref, PubMed, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CR

. 2018 טלומרים אקטותרמיים: הגיע הזמן שהם ייכנסו מהקור. פיל. עָבָר. R. Soc. ב 373, 20160449. (doi: 10.1098/rstb.2016.0449) קישור, ISI, Google Scholar

Gomes N, Shay JW, Wright WE

. 2010 ביולוגיה של טלומרים במטאזואה. FEBS Lett. 584, 3741-3751. (doi:10.1016/j.febslet.2010.07.031) Crossref, PubMed, ISI, Google Scholar

. תיקון כריתת DNA ב-2015 בטלומרים. תיקון DNA 36, 137-145. (doi:10.1016/j.dnarep.2015.09.017) Crossref, PubMed, ISI, Google Scholar

. 2018 DNA נזק, תיקון ותחזוקה של אורך הטלומרים: תפקידם של תוספי תזונה. ב מוטגניות: מבחני ויישומים (עורכים

Kumar A, Dobrovolsky VN, Dhawan A, Shanker R

), עמ' 287-307. אמסטרדם, הולנד: Elsevier. Google Scholar

2017 שכיחות סרטן ואטיולוגיה בבעלי חיים בטבע ובשבי. ב אקולוגיה ואבולוציה של סרטן (עורכים

Ujvari B, Roche B, Thomas F

), עמ' 11-46. לונדון, בריטניה: עיתונות אקדמית. פרסומת, Google Scholar

. 2009 טלומרים ומחלות. EMBO J. 28, 2532-2540. (doi:10.1038/emboj.2009.172) Crossref, PubMed, ISI, Google Scholar

. 2012 תסמונות הטלומרים. נאט. הכומר ג'נט. 13, 693-704. (doi:10.1038/nrg3436) Crossref, PubMed, ISI, Google Scholar

Stone RC, Horvath K, Kark JD, Susser E, Tishkoff SA, Aviv A

. 2016 אורך הטלומרים והפשרה בין סרטן וטרשת עורקים. PLoS Genet. 12, e1006144. (doi:10.1371/journal.pgen.1006144) Crossref, PubMed, ISI, Google Scholar

בארט אלב, ריצ'רדסון DS

. 2011 הבדלי מין בטלומרים ובתוחלת חיים. תא מזדקן 10, 913-921. (doi:10.1111/j.1474-9726.2011.00741.x) Crossref, PubMed, ISI, Google Scholar

2014 מגדר ואורך טלומרים: סקירה שיטתית ומטה-אנליזה. Exp. ג'רונטול. 51, 15-27. (doi:10.1016/j.exger.2013.12.004) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Giraudeau M, Wilson M, Olsson M

. 2017 דינמיקה של טלומרים בלטאה עם השקעה ותחזוקה עצמית של רבייה ספציפית. אקול. Evol. 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Asghar M, Palinauskas V, Zaghdoudi-Allan N, Valkiunas G, Mukhin A, Platonova E, Farnert A, Bensch S, Hasselquist D

. 2016 קיצור טלומר מקביל ברקמות גוף מרובות עקב זיהום במלריה. פרוק. R. Soc. לונד. ביול. Sci. 283, 20161184. (doi:10.1098/rspb.2016.1184) קישור, ISI, Google Scholar

Rollings N, Friesen CR, Whittington CM, Johansson R, Shine R, Olsson M

. 2019 הבדלים ספציפיים למין ולרקמות באורך הטלומרים אצל זוחל. אקול. Evol. 9, 6211-6219. (doi:10.1002/ece3.5164) PubMed, ISI, Google Scholar

Benetos A, Kimura M, Labat C, Buchoff GM, Huber S, Labat L, Lu XB, Aviv A

. 2011 מודל של דינמיקה של טלומרים של לויקוציטים של כלבים. תא מזדקן 10, 991-995. (doi:10.1111/j.1474-9726.2011.00744.x) Crossref, PubMed, ISI, Google Scholar

Daniali L, Benetos A, Susser E, Kark JD, Labat C, Kimura M, Desai K, Granick M, Aviv A

. 2013 הטלומרים מתקצרים בשיעורים מקבילים ברקמות סומטיות של מבוגרים. נאט. Commun. 4, 1597. (doi:10.1038/ncomms2602) Crossref, PubMed, ISI, Google Scholar

רייכרט S, Criscuolo F, Verinaud E, Zahn S, Massemin S

. 2013 מתאמים לאורך הטלומרים בין רקמות סומטיות בחוחיות זברה בוגרות. PLoS ONE 8, e81496. (doi:10.1371/journal.pone.0081496) Crossref, PubMed, ISI, Google Scholar

. 2004 המטולוגיה של חולייתנים תחתונים. במפגש השנתי ה-55 של הקולג' האמריקאי לפתולוגים וטרינרים (ACVP) ובמפגש השנתי ה-39 של האגודה האמריקאית לפתולוגיה קלינית (ASVCP). מידלטון, WI: המכללה האמריקאית לפתולוגים וטרינרים והאגודה האמריקאית לפתולוגיה וטרינרית קלינית. Google Scholar

Beaulieu M, Benoit L, Abaga S, Kappeler PM, Charpantier MJE

. 2017 שימו לב לתא: שונות עונתית באורך הטלומרים משקפת שינויים בפרופיל הלויקוציטים. מול. אקול. 26, 5603-5613. (doi:10/1111/mec.14329) Crossref, PubMed, ISI, Google Scholar

. 2009 מורפולוגיה השוואתית, התפתחות ותפקוד של תאי דם בחולייתנים שאינם יונקים. ג'יי אקזוט. חיית מחמד. Med. 18, 87-97. Crossref, ISI, Google Scholar

. 2019 פיזיולוגיה של תאי דם אדומים ולבנים. אנסט. טיפול נמרץ מד. 20, 170-174. (doi:10.1016/j.mpaic.2019.01.001) Crossref, ISI, Google Scholar

. 2002 מתח חמצוני מקצר את הטלומרים. טרנדים ביוכימיה. Sci. 27, 339-344. (doi:10.1016/S0968-0004(02)02110-2) Crossref, PubMed, ISI, Google Scholar

Baerlocher GM, Lansdorp PM

. 2003 מדידות אורך טלומרים בתת-קבוצות של לויקוציטים על ידי Flow-FISH אוטומטי רב-צבעוני. ציטומטריה חלק א' 55A, 1-6. (doi:10.1002/cyto.a.10064) Crossref, ISI, Google Scholar

Carvalho de MP, Queiroz-Hazarbassanov NG, Massoco CO, Rossi S, Sant'Anna SS, Catão-Dias JL, Grego KF

. אפיון ציטומטרי זרימה 2016 של אוכלוסיות לויקוציטים בדם היקפי של 3 מיני נחשים ניאוטרופיים: בואה מכווצת, Bothrops jararaca, ו Crotalus durissus . וטרינר. קלינ. פאתול. 45, 271-280. (doi: 10.1111/vcp.12358) Crossref, PubMed, ISI, Google Scholar

Carvalho de MPN, Queiroz-Hazarbassanov NGT, de Oliveira Massoco C, Sant'Anna SS, Lourenço MM, Levin G, Sogayar MC, Grego KF, Catão-Dias JL

. 2017 אפיון פונקציונלי של תת-קבוצות של לויקוציטים בדם היקפי נחשים ניאוטרופיים: קישור בין תכונות תאי זרימה, תמונות מיקרוסקופיה ורמות קורטיקוסטרון בסרום. Dev. Comp. אימונול. 74, 144-153. (doi:10.1016/j.dci.2017.04.007) Crossref, PubMed, ISI, Google Scholar

Olsson M, Friesen CR, Rollings N, Sudyka J, Lindsay W, Whittington C, Wilson MR

. 2018 השפעות ארוכות טווח של תיקון סופראוקסיד ו-DNA על טלומרים של לטאה. מול. אקול. 27, 5154-5164. (doi:10.1111/mec.14913) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Wilson M, Olsson M

. 2017 דינמיקה של טלומרים בלטאה עם השקעה ותחזוקה עצמית של רבייה ספציפית. אקול. Evol. 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Schwartz T, Lebas N, Uller T

. 2007 וריאציה של מערכת ההזדווגות ותנודות המורפים בלטאה פולימורפית. מול. אקול. 16, 5307-5315. (doi:10.1111/j.1365-294X.2007.03578.x) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Uller T

. 2009 בדיקת איכות נשא: ניסוי שדה על מאותתים של לטאות. אבולוציה 63, 695-701. (doi:10.1111/j.1558-5646.2008.00569.x) Crossref, PubMed, ISI, Google Scholar

. 2009 גדול מדי עבור המגפיים שלו: האם עלויות סוציאליות בשמירה על מצב תלוי מצב מעידים על כנות אצל לטאה אוסטרלית? אוסטרל אקול. 34, 636-640. (doi:10.1111/j.1442-9993.2009.01968.x) Crossref, ISI, Google Scholar

. 2000 Chapter 21: Reptilian complete blood count . ב Laboratory medicine: avian and exotic pets (ed.

), pp. 193-197. Philadelphia, PA : W.B. Saunders Company . Google Scholar

Stacy NI, Alleman AR, Sayler KA

. 2011 Diagnostic hematology of reptiles . קלינ. מַעבָּדָה. Med. 31, 87-108. (doi:10.1016/j.cll.2010.10.006) Crossref, PubMed, ISI, Google Scholar

. 2008 Hematologic evaluation is mainstay of diagnosis for reptiles . וטרינר. Tech. 29, 616. Google Scholar

Nazarpour R, Zabihi E, Alijanpour E, Abedian Z, Mehdizadeh H, Rahimi F

. 2012 Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation . Int. י.מול. תָא. Med. 1, 88-93. PubMed, Google Scholar

. 1991 Structure and function of telomeres . טֶבַע 350, 569-573. (doi: 10.1038/350569a0) Crossref, PubMed, ISI, Google Scholar

Fischer U, Ototake M, Nakanishi T

. 1998 Lifespan of circulating blood cells in ginbuna crucian carp (Carassius auratus langsdorfii) . Fish Shellfish Immunol. 8, 339-349. (doi:10.1006/fsim.1998.0144) Crossref, ISI, Google Scholar

Asghar M, Hasselquist D, Hansson B, Zehtindjiev P, Westerdahl H, Bensch S

. 2015 Hidden costs of infection: chronic malaria accelerates telomere degradation and senescence in wild birds . מַדָע 347, 436-438. (doi10.1126/science.1261121) Crossref, PubMed, ISI, Google Scholar

Angelier F, Costantini D, Blévin P, Chastel O

. 2018 Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? ביקורת . Gen. Comp. אנדוקרינול. 256, 99-111. (doi:10.1016/j.ygcen.2017.07.007) Crossref, PubMed, ISI, Google Scholar

Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD

. 2004 Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells . J. Cell Sci. 117, 2417-2426. (doi:10.1242/jcs.01097) Crossref, PubMed, ISI, Google Scholar

Fouquerel E, Parikh D, Opresko P

. 2016 DNA damage processing at telomeres: the ends justify the means . תיקון DNA 44, 159-168. (doi:10.1016/j.dnarep.2016.05.022) Crossref, PubMed, ISI, Google Scholar

Sardina JL, Lopez-Ruano G, Sanchez-Sanchez B, Llanillo M, Hernandez-Hernandez A


Design and methods

Setting and subjects

This analysis was performed within the framework of the Prevention of Renal and Vascular End-Stage Disease (PREVEND, www.prevend.org) study. The PREVEND study is an ongoing, longitudinal, general, population-based cohort study of individuals aged 28–75 years living in the city of Groningen, the Netherlands. For the present study, we included subjects who donated a full blood sample for DNA extraction at baseline (T1) and/or during the first (T2) and/or the second (T3) follow-up visit. Details of the study have been described previously 15 . In brief, 8592 subjects completed the baseline survey (1997–1998) and were invited to visit the outpatient department after approximately 4.3 years for the first and approximately 6.6 years for the second follow-up visit. At each visit, demographic and anthropometric characteristics and serum biomarkers were assessed. The PREVEND study has been approved by the local medical ethics committee and is being conducted in accordance with the guidelines of the Declaration of Helsinki. All participants provided written informed consent before enrolment.

Measurement of telomere length

Details of the methods of DNA extraction and of telomere length measurements are provided in the Appendix S1. In brief, all samples for DNA collected at different time-points were mixed and randomly extracted using a standard DNA extraction kit (QIamp, Qiagen, Venlo, the Netherlands) to neutralize potential batch effects. Mean relative leukocyte telomere length was measured using a monochrome multiplex real-time quantitative polymerase chain reaction technique (developed by R.M.C.) 16 . This technique enables the telomere-specific amplification and the single copy gene (reference) amplification to be carried out in a single reaction well with quantification measurements at different temperatures 16 . The ratio of telomere (T) to single copy gene (S) content (T/S ratio) is a relative measure of telomere length (RTL) and is expressed in arbitrary units (RTLU). All samples were measured in triplicate, and the average of the three runs was used to provide the mean RTLU for each individual. The intra-assay coefficients of variation were 2.0%, 1.9% and 4.5% for T, S and the T/S ratio, respectively.

We adhered to the arbitrary categorization of telomere trajectories as previously reported: shortening was defined as a >10% decrease in RTL, stable as a ≤10% change in RTL and elongation as a >10% increase in RTL at T3 compared to baseline 17, 18 .

Other measurements and definitions

All participants completed a questionnaire regarding demographic profile and smoking habits. Smoking was categorized as current smoking, previous smoking and nonsmoking. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m 2 ) and categorized as follows: normal, <25 kg m −2 overweight, 25–30 kg m −2 and obese, ≥30 kg m −2 . Hypertension was defined as systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg or the use of antihypertensive medication prehypertension was defined as systolic blood pressure <140 and ≥120 mmHg and diastolic blood pressure <90 and ≥80 mmHg and normotension was defined as both systolic blood pressure <120 mmHg and diastolic blood pressure <80 mmHg. Diabetes was defined as a fasting plasma glucose level of ≥126 mg dL −1 (7.0 mmol L −1 ), a nonfasting plasma glucose level of ≥200 mg dL −1 (11.1 mmol L −1 ) or the use of oral antidiabetic agents. Hypercholesterolaemia was defined as a total cholesterol level of ≥250 mg dL −1 (6.5 mmol L −1 ) or the use of lipid-lowering medication ≤200 mg dL −1 (5.13 mmol L −1 ) was considered an optimal cholesterol concentration. Estimated glomerular filtration rate (eGFR) was calculated using the Modification of Diet in Renal Disease (MDRD) study equation taking into account sex, age, ethnicity and serum creatinine levels 19 . Details of the measurement methods can be found in the Appendix S1.

ניתוח סטטיסטי

To obtain a normal distribution, telomere length was natural-log-transformed. Other continuous variables with a skewed distribution (creatinine, insulin, glucose, high-sensitivity C-reactive protein, cholesterol, HDL and triglycerides) were also natural-log-transformed prior to analysis. Individuals in the bottom and top 0.5% of the RTL distribution were excluded to limit the undue influence of outliers in the regression analysis. Differences in telomere lengths between groups were tested using Student's ט-test or one-way anova . Cross-sectional associations between variables and telomere length were evaluated using standard linear regression models. Multivariate linear regression models were used to adjust for age and gender. To investigate telomere dynamics across time, two-level hierarchical growth models were constructed. Variables were centred around the grand mean (i.e. the mean was set to zero). Details of the model-building strategy, centring and multitest correction are provided in the Appendix S1.


מסקנות

Numerous observational studies of TL have been conducted among breast cancer patients in the last 20 years. Despite the major methodologic differences between studies, when considering all the studies (peripheral blood and tumor tissue) and all outcomes together, there was a trend toward an association of longer telomeres with a better prognosis. Further longitudinal studies with rigorous methodology, including proper control of confounding and an adequate TL measurement method, are still needed to determine the exact prognostic significance of TL for breast cancer patients.


צפו בסרטון: Cryo-EM structure of substrate-bound human telomerase holoenzyme (פברואר 2023).